Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CEACAM1 cdna clone

CEACAM1 cDNA Clone

Gene Names
CEACAM1; BGP; BGP1; BGPI
Synonyms
CEACAM1; CEACAM1 cDNA Clone; CEACAM1 cdna clone
Ordering
For Research Use Only!
Sequence
atggggcacctctcagccccacttcacagagtgcgtgtaccctggcaggggcttctgctcacagcctcacttctaaccttctggaacccgcccaccactgcccagctcactactgaatccatgccattcaatgttgcagaggggaaggaggttcttctccttgtccacaatctgccccagcaactttttggctacagctggtacaaaggggaaagagtggatggcaaccgtcaaattgtaggatatgcaataggaactcaacaagctaccccagggcccgcaaacagcggtcgagagacaatataccccaatgcatccctgctgatccagaacgtcacccagaatgacacaggattctacaccctacaagtcataaagtcagatcttgtgaatgaagaagcaactggacagttccatgtatacccggagctgcccaagccctccatctccagcaacaactccaaccctgtggaggacaaggatgctgtggccttcacctgtgaacctgagactcaggacacaacctacctgtggtggataaacaatcagagcctcccggtcagtcccaggctgcagctgtccaatggcaacaggaccctcactctactcagtgtcacaaggaatgacacaggaccctatgagtgtgaaatacagaacccagtgagtgcgaaccgcagtgacccagtcaccttgaatgtcacctatggcccggacacccccaccatttccccttcagacacctattaccgtccaggggcaaacctcagcctctcctgctatgcagcctctaacccacctgcacagtactcctggcttatcaatggaacattccagcaaagcacacaagagctctttatccctaacatcactgtgaataatagtggatcctatacctgccacgccaataactcagtcactggctgcaacaggaccacagtcaagacgatcatagtcactgagctaagtccagtagtagcaaagccccaaatcaaagccagcaagaccacagtcacaggagataaggactctgtgaacctgacctgctccacaaatgacactggaatctccatccgttggttcttcaaaaaccagagtctcccgtcctcggagaggatgaagctgtcccagggcaacaccaccctcagcataaaccctgtcaagagggaggatgctgggacgtattggtgtgaggtcttcaacccaatcagtaagaaccaaagcgaccccatcatgctgaacgtaaactataatgctctaccacaagaaaatggcctctcacctggggccattgctggcattgtgattggagtagtggccctggttgctctgatagcagtagccctggcatgttttctgcatttcgggaagaccggcaggaccactccaatgacccacctaacaagatga
Sequence Length
1407
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
634
Molecular Weight
39,871 Da
NCBI Official Full Name
Homo sapiens carcinoembryonic antigen-related cell adhesion molecule 1 (biliary glycoprotein), mRNA
NCBI Official Synonym Full Names
carcinoembryonic antigen related cell adhesion molecule 1
NCBI Official Symbol
CEACAM1
NCBI Official Synonym Symbols
BGP; BGP1; BGPI
NCBI Protein Information
carcinoembryonic antigen-related cell adhesion molecule 1
UniProt Protein Name
Carcinoembryonic antigen-related cell adhesion molecule 1
Protein Family
UniProt Gene Name
CEACAM1
UniProt Synonym Gene Names
BGP; BGP1; BGP-1
UniProt Entry Name
CEAM1_HUMAN

NCBI Description

This gene encodes a member of the carcinoembryonic antigen (CEA) gene family, which belongs to the immunoglobulin superfamily. Two subgroups of the CEA family, the CEA cell adhesion molecules and the pregnancy-specific glycoproteins, are located within a 1.2 Mb cluster on the long arm of chromosome 19. Eleven pseudogenes of the CEA cell adhesion molecule subgroup are also found in the cluster. The encoded protein was originally described in bile ducts of liver as biliary glycoprotein. Subsequently, it was found to be a cell-cell adhesion molecule detected on leukocytes, epithelia, and endothelia. The encoded protein mediates cell adhesion via homophilic as well as heterophilic binding to other proteins of the subgroup. Multiple cellular activities have been attributed to the encoded protein, including roles in the differentiation and arrangement of tissue three-dimensional structure, angiogenesis, apoptosis, tumor suppression, metastasis, and the modulation of innate and adaptive immune responses. Multiple transcript variants encoding different isoforms have been reported, but the full-length nature of all variants has not been defined. [provided by RefSeq, May 2010]

Uniprot Description

CEACAM1: carcinoembryonic antigen-related cell adhesion molecule 1. A cell-cell adhesion molecule that directly associates with annexin II. Has tumor suppressor activity in prostate carcinoma. Belongs to the immunoglobulin superfamily and the CEA family. Abundantly expressed in epithelia, vessel endothelia, trophoblasts, platelets and neutrophilic granulocytes. Also present in many cell types of the immune system such as B cells, T cells, NK cells, macrophages and dendritic cells. Five alternatively spliced isoforms have been described. Two isoforms are type I membrane proteins, while three are secreted.

Protein type: Cell adhesion; Immunoglobulin superfamily; Motility/polarity/chemotaxis; Membrane protein, integral

Chromosomal Location of Human Ortholog: 19q13.2

Cellular Component: adherens junction; apical plasma membrane; basal plasma membrane; cell junction; cell surface; integral to membrane; intercellular junction; lateral plasma membrane; membrane; plasma membrane; T cell receptor complex

Molecular Function: actin binding; bile acid transmembrane transporter activity; filamin binding; kinase binding; protein binding; protein dimerization activity; protein homodimerization activity; protein phosphatase binding

Biological Process: bile acid and bile salt transport; blood vessel development; cell adhesion; cellular response to insulin stimulus; homophilic cell adhesion; leukocyte migration; negative regulation of cytotoxic T cell degranulation; negative regulation of fatty acid biosynthetic process; negative regulation of granulocyte differentiation; negative regulation of interleukin-1 production; negative regulation of lipid biosynthetic process; negative regulation of natural killer cell mediated cytotoxicity directed against tumor cell target; negative regulation of protein kinase activity; negative regulation of T cell mediated cytotoxicity; negative regulation of T cell receptor signaling pathway; negative regulation of vascular permeability; regulation of cell growth; regulation of cell migration; regulation of endothelial cell differentiation; regulation of epidermal growth factor receptor signaling pathway; regulation of phosphoinositide 3-kinase cascade

Research Articles on CEACAM1

Similar Products

Product Notes

The CEACAM1 ceacam1 (Catalog #AAA1278645) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggggcacc tctcagcccc acttcacaga gtgcgtgtac cctggcaggg gcttctgctc acagcctcac ttctaacctt ctggaacccg cccaccactg cccagctcac tactgaatcc atgccattca atgttgcaga ggggaaggag gttcttctcc ttgtccacaa tctgccccag caactttttg gctacagctg gtacaaaggg gaaagagtgg atggcaaccg tcaaattgta ggatatgcaa taggaactca acaagctacc ccagggcccg caaacagcgg tcgagagaca atatacccca atgcatccct gctgatccag aacgtcaccc agaatgacac aggattctac accctacaag tcataaagtc agatcttgtg aatgaagaag caactggaca gttccatgta tacccggagc tgcccaagcc ctccatctcc agcaacaact ccaaccctgt ggaggacaag gatgctgtgg ccttcacctg tgaacctgag actcaggaca caacctacct gtggtggata aacaatcaga gcctcccggt cagtcccagg ctgcagctgt ccaatggcaa caggaccctc actctactca gtgtcacaag gaatgacaca ggaccctatg agtgtgaaat acagaaccca gtgagtgcga accgcagtga cccagtcacc ttgaatgtca cctatggccc ggacaccccc accatttccc cttcagacac ctattaccgt ccaggggcaa acctcagcct ctcctgctat gcagcctcta acccacctgc acagtactcc tggcttatca atggaacatt ccagcaaagc acacaagagc tctttatccc taacatcact gtgaataata gtggatccta tacctgccac gccaataact cagtcactgg ctgcaacagg accacagtca agacgatcat agtcactgag ctaagtccag tagtagcaaa gccccaaatc aaagccagca agaccacagt cacaggagat aaggactctg tgaacctgac ctgctccaca aatgacactg gaatctccat ccgttggttc ttcaaaaacc agagtctccc gtcctcggag aggatgaagc tgtcccaggg caacaccacc ctcagcataa accctgtcaa gagggaggat gctgggacgt attggtgtga ggtcttcaac ccaatcagta agaaccaaag cgaccccatc atgctgaacg taaactataa tgctctacca caagaaaatg gcctctcacc tggggccatt gctggcattg tgattggagt agtggccctg gttgctctga tagcagtagc cctggcatgt tttctgcatt tcgggaagac cggcaggacc actccaatga cccacctaac aagatga. It is sometimes possible for the material contained within the vial of "CEACAM1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.