Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ETHE1 cdna clone

ETHE1 cDNA Clone

Gene Names
ETHE1; HSCO; YF13H12
Synonyms
ETHE1; ETHE1 cDNA Clone; ETHE1 cdna clone
Ordering
For Research Use Only!
Sequence
atggcggaggctgtactgagggtcgcccggcggcagctgagccagcgcggcgggtctggagcccccatcctcctgcggcagatgttcgagcctgtgagctgcaccttcacgtacctgctgggtgacagagagtcccgggaggccgttctgatcgacccagtcctggaaacagcgcctcgggatgcccagctgatcaaggagctggggctgcggctgctctatgctgtgaatacccactgccacgcggaccacattacaggctcggggctgctccgttccctcctccctggctgccagtctgtcatctcccgccttagtggggcccaggctgacttacacattgaggatggagactccatccgcttcgggcgcttcgcgttggagaccagggccagccctggccacaccccaggctgtgtcaccttcgtcctgaatgaccacagcatggccttcactggagatgccctgttgatccgtgggtgtgggcggacagacttccagcaaggctgtgccaagaccttgtaccactcggtccatgaaaagatcttcacacttccaggagactgtctgatctaccctgctcacgattaccatgggttcacagtgtccaccgtggaggaggagaggactctgaaccctcggctcaccctcagctgtgaggagtttgtcaaaatcatgggcaacctgaacttgcctaaacctcagcagatagactttgctgttccagccaacatgcgctgtggggtgcagacacccactgcctga
Sequence Length
765
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
27,873 Da
NCBI Official Full Name
Homo sapiens ethylmalonic encephalopathy 1, mRNA
NCBI Official Synonym Full Names
ETHE1, persulfide dioxygenase
NCBI Official Symbol
ETHE1
NCBI Official Synonym Symbols
HSCO; YF13H12
NCBI Protein Information
persulfide dioxygenase ETHE1, mitochondrial
UniProt Protein Name
Persulfide dioxygenase ETHE1, mitochondrial
Protein Family
UniProt Gene Name
ETHE1
UniProt Synonym Gene Names
HSCO
UniProt Entry Name
ETHE1_HUMAN

NCBI Description

This gene encodes a member of the metallo beta-lactamase family of iron-containing proteins involved in the mitochondrial sulfide oxidation pathway. The encoded protein catalyzes the oxidation of a persulfide substrate to sulfite. Certain mutations in this gene cause ethylmalonic encephalopathy, an infantile metabolic disorder affecting the brain, gastrointestinal tract and peripheral vessels. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2016]

Uniprot Description

ETHE1: Probably plays an important role in metabolic homeostasis in mitochondria. May function as a nuclear-cytoplasmic shuttling protein that binds transcription factor RELA/NFKB3 in the nucleus and exports it to the cytoplasm. Suppresses p53- induced apoptosis by preventing nuclear localization of RELA. Defects in ETHE1 are a cause of ethylmalonic encephalopathy (EE). EE is an autosomal recessive disorder characterized by neurodevelopmental delay and regression, recurrent petechiae, acrocyanosis, diarrhea, leading to death in the first decade of life. It is also associated with persistent lactic acidemia and ethylmalonic and methylsuccinic aciduria. Belongs to the metallo-beta-lactamase superfamily. Glyoxalase II family.

Protein type: Mitochondrial; Hydrolase; EC 1.13.11.18

Chromosomal Location of Human Ortholog: 19q13.31

Cellular Component: cytoplasm; mitochondrial matrix; mitochondrion; nucleoplasm

Molecular Function: iron ion binding; sulfur dioxygenase activity

Biological Process: glutathione metabolic process

Disease: Encephalopathy, Ethylmalonic

Research Articles on ETHE1

Similar Products

Product Notes

The ETHE1 ethe1 (Catalog #AAA1278620) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcggagg ctgtactgag ggtcgcccgg cggcagctga gccagcgcgg cgggtctgga gcccccatcc tcctgcggca gatgttcgag cctgtgagct gcaccttcac gtacctgctg ggtgacagag agtcccggga ggccgttctg atcgacccag tcctggaaac agcgcctcgg gatgcccagc tgatcaagga gctggggctg cggctgctct atgctgtgaa tacccactgc cacgcggacc acattacagg ctcggggctg ctccgttccc tcctccctgg ctgccagtct gtcatctccc gccttagtgg ggcccaggct gacttacaca ttgaggatgg agactccatc cgcttcgggc gcttcgcgtt ggagaccagg gccagccctg gccacacccc aggctgtgtc accttcgtcc tgaatgacca cagcatggcc ttcactggag atgccctgtt gatccgtggg tgtgggcgga cagacttcca gcaaggctgt gccaagacct tgtaccactc ggtccatgaa aagatcttca cacttccagg agactgtctg atctaccctg ctcacgatta ccatgggttc acagtgtcca ccgtggagga ggagaggact ctgaaccctc ggctcaccct cagctgtgag gagtttgtca aaatcatggg caacctgaac ttgcctaaac ctcagcagat agactttgct gttccagcca acatgcgctg tggggtgcag acacccactg cctga. It is sometimes possible for the material contained within the vial of "ETHE1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.