Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SIGLEC12 cdna clone

SIGLEC12 cDNA Clone

Gene Names
SIGLEC12; S2V; SLG; SIGLECL1; Siglec-XII
Synonyms
SIGLEC12; SIGLEC12 cDNA Clone; SIGLEC12 cdna clone
Ordering
For Research Use Only!
Sequence
atgctactgctgctgctactgctgccacccctgctctgtgggagagtgggggctaaggaacagaaggattacctgctgacaatgcagaagtccgtgacggtgcaggagggcctgtgtgtctctgtgctttgctccttctcctacccccaaaatggctggactgcctccgatccagttcatggctactggttccgggcaggggaccatgtaagccggaacattccagtggccacaaacaacccagctcgagcagtgcaggaggagactcgggaccgattccacctccttggggacccacagaacaaggattgtaccctgagcatcagagacaccagagagagtgatgcagggacatacgtcttttgtgtagagagaggaaatatgaaatggaattataaatatgaccagctctctgtgaatgtgacagcgtcccaggacctactgtcaagatacaggctggaggtgccagagtcggtgactgtgcaggagggtctgtgtgtctctgtgccctgcagtgtcctttacccccattacaactggactgcctctagccctgtttatggatcctggttcaaggaaggggccgatataccatgggatattccagtggccacaaacaccccaagtggaaaagtgcaagaggatacccacggtcgattcctcctccttggggacccacagaccaacaactgctccctgagcatcagagatgccaggaagggggattcagggaagtactacttccaggtggagagaggaagcaggaaatggaactacatatatgacaagctctctgtgcatgtgacagccctgactcacatgcccaccttctccatcccggggaccctggagtctggccaccccaggaacctgacctgctctgtgccctgggcctgtgaacaggggacgccccccacgatcacctggatgggggcctccgtgtcctccctggaccccactatcactcgctcctcgatgctcagcctcatcccacagccccaggaccatggcaccagcctcacctgtcaggtgaccttgcctggggccggcgtgaccatgaccagggctgtccgactcaacatatcctatcctcctcagaacttgaccatgactgtcttccaaggagatggcacagcatccacaaccttgaggaatggctcggccctttcagtcctggagggccagtccctgcaccttgtctgtgctgtcgacagcaatccccctgccaggctgagctggacctgggggagcctgaccctgagcccctcacagtcctcgaaccttggggtgctggagctgcctcgagtgcatgtgaaggatgaaggggaattcacctgccgagctcagaaccctctaggctcccagcacatttccctgagcctctccctgcaaaacgagtacacaggcaaaatgaggcctatatcaggagtgacgctaggggcattcgggggagctggagccacagccctggtcttcctgtacttctgcatcatcttcgttgtagtgaggtcctgcaggaagaaatcggcaaggccagcagtgggcgtgggggatacaggcatggaggacgcaaacgctgtcaggggctcagcctctcagggacccctgattgaatccccggcagatgacagccccccacaccatgctccgccagccctggccaccccctccccagaggaaggagagatccagtatgcatccctcagcttccacaaagcgaggcctcagtacccacaggaacaggaggccatcggctatgagtactccgagatcaacatccccaagtga
Sequence Length
1788
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
51,663 Da
NCBI Official Full Name
Homo sapiens sialic acid binding Ig-like lectin 12, mRNA
NCBI Official Synonym Full Names
sialic acid binding Ig like lectin 12 (gene/pseudogene)
NCBI Official Symbol
SIGLEC12
NCBI Official Synonym Symbols
S2V; SLG; SIGLECL1; Siglec-XII
NCBI Protein Information
sialic acid-binding Ig-like lectin 12
UniProt Protein Name
Sialic acid-binding Ig-like lectin 12
UniProt Gene Name
SIGLEC12
UniProt Synonym Gene Names
SIGLECL1; SLG; Siglec-12; Siglec-L1
UniProt Entry Name
SIG12_HUMAN

NCBI Description

Sialic acid-binding immunoglobulin-like lectins (SIGLECs) are a family of cell surface proteins belonging to the immunoglobulin superfamily. They mediate protein-carbohydrate interactions by selectively binding to different sialic acid moieties present on glycolipids and glycoproteins. This gene encodes a member of the SIGLEC3-like subfamily of SIGLECs. Members of this subfamily are characterized by an extracellular V-set immunoglobulin-like domain followed by two C2-set immunoglobulin-like domains, and the cytoplasmic tyrosine-based motifs ITIM and SLAM-like. The encoded protein, upon tyrosine phosphorylation, has been shown to recruit the Src homology 2 domain-containing protein-tyrosine phosphatases SHP1 and SHP2. It has been suggested that the protein is involved in the negative regulation of macrophage signaling by functioning as an inhibitory receptor. This gene is located in a cluster with other SIGLEC3-like genes on 19q13.4. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]

Uniprot Description

SIGLEC12: Putative adhesion molecule that mediates sialic-acid dependent binding to cells. The sialic acid recognition site may be masked by cis interactions with sialic acids on the same cell surface. Belongs to the immunoglobulin superfamily. SIGLEC (sialic acid binding Ig-like lectin) family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Cell surface; Membrane protein, integral

Chromosomal Location of Human Ortholog: 19q13.4

Research Articles on SIGLEC12

Similar Products

Product Notes

The SIGLEC12 siglec12 (Catalog #AAA1278570) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgctactgc tgctgctact gctgccaccc ctgctctgtg ggagagtggg ggctaaggaa cagaaggatt acctgctgac aatgcagaag tccgtgacgg tgcaggaggg cctgtgtgtc tctgtgcttt gctccttctc ctacccccaa aatggctgga ctgcctccga tccagttcat ggctactggt tccgggcagg ggaccatgta agccggaaca ttccagtggc cacaaacaac ccagctcgag cagtgcagga ggagactcgg gaccgattcc acctccttgg ggacccacag aacaaggatt gtaccctgag catcagagac accagagaga gtgatgcagg gacatacgtc ttttgtgtag agagaggaaa tatgaaatgg aattataaat atgaccagct ctctgtgaat gtgacagcgt cccaggacct actgtcaaga tacaggctgg aggtgccaga gtcggtgact gtgcaggagg gtctgtgtgt ctctgtgccc tgcagtgtcc tttaccccca ttacaactgg actgcctcta gccctgttta tggatcctgg ttcaaggaag gggccgatat accatgggat attccagtgg ccacaaacac cccaagtgga aaagtgcaag aggataccca cggtcgattc ctcctccttg gggacccaca gaccaacaac tgctccctga gcatcagaga tgccaggaag ggggattcag ggaagtacta cttccaggtg gagagaggaa gcaggaaatg gaactacata tatgacaagc tctctgtgca tgtgacagcc ctgactcaca tgcccacctt ctccatcccg gggaccctgg agtctggcca ccccaggaac ctgacctgct ctgtgccctg ggcctgtgaa caggggacgc cccccacgat cacctggatg ggggcctccg tgtcctccct ggaccccact atcactcgct cctcgatgct cagcctcatc ccacagcccc aggaccatgg caccagcctc acctgtcagg tgaccttgcc tggggccggc gtgaccatga ccagggctgt ccgactcaac atatcctatc ctcctcagaa cttgaccatg actgtcttcc aaggagatgg cacagcatcc acaaccttga ggaatggctc ggccctttca gtcctggagg gccagtccct gcaccttgtc tgtgctgtcg acagcaatcc ccctgccagg ctgagctgga cctgggggag cctgaccctg agcccctcac agtcctcgaa ccttggggtg ctggagctgc ctcgagtgca tgtgaaggat gaaggggaat tcacctgccg agctcagaac cctctaggct cccagcacat ttccctgagc ctctccctgc aaaacgagta cacaggcaaa atgaggccta tatcaggagt gacgctaggg gcattcgggg gagctggagc cacagccctg gtcttcctgt acttctgcat catcttcgtt gtagtgaggt cctgcaggaa gaaatcggca aggccagcag tgggcgtggg ggatacaggc atggaggacg caaacgctgt caggggctca gcctctcagg gacccctgat tgaatccccg gcagatgaca gccccccaca ccatgctccg ccagccctgg ccaccccctc cccagaggaa ggagagatcc agtatgcatc cctcagcttc cacaaagcga ggcctcagta cccacaggaa caggaggcca tcggctatga gtactccgag atcaacatcc ccaagtga. It is sometimes possible for the material contained within the vial of "SIGLEC12, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.