Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

IFNAR2 cdna clone

IFNAR2 cDNA Clone

Gene Names
IFNAR2; IFN-R; IMD45; IFNABR; IFNARB; IFN-alpha-REC
Synonyms
IFNAR2; IFNAR2 cDNA Clone; IFNAR2 cdna clone
Ordering
For Research Use Only!
Sequence
atgcttttgagccagaatgccttcatcgtcagatcacttaatttggttctcatggtgtatatcagcctcgtgtttggtatttcatatgattcgcctgattacacagatgaatcttgcactttcaagatatcattgcgaaatttccggtccatcttatcatgggaattaaaaaaccactccattgtaccaactcactatacattgctgtatacaatcatgagtaaaccagaagatttgaaggtggttaagaactgtgcaaataccacaagatcattttgtgacctcacagatgagtggagaagcacacacgaggcctatgtcaccgtcctagaaggattcagcgggaacacaacgttgttcagttgctcacacaatttctggctggccatagacatgtcttttgaaccaccagagtttgagattgttggttttaccaaccacattaatgtgatggtgaaatttccatctattgttgaggaagaattacagtttgatttatctctcgtcattgaagaacagtcagagggaattgttaagaagcataaacccgaaataaaaggaaacatgagtggaaatttcacctatatcattgacaagttaattccaaacacgaactactgtgtatctgtttatttagagcacagtgatgagcaagcagtaataaagtctcccttaaaatgcaccctccttccacctggccaggaatcagaatcagcagaatctgccaaaataggaggaataattactgtgtttttgatagcattggtcttgacaagcaccatagtgacactgaaatggattggttatatatgcttaagaaatagcctccccaaagtcttgaggcaaggtctcactaagggctggaatgcagtggctattcacaggtgcagtcataatgcactacagtctgaaactcctgagctcaaacagtcgtcctgcctaagcttccccagtagctgggattacaagcgtgcatccctgtgccccagtgattaa
Sequence Length
996
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
27,384 Da
NCBI Official Full Name
Homo sapiens interferon (alpha, beta and omega) receptor 2, mRNA
NCBI Official Synonym Full Names
interferon alpha and beta receptor subunit 2
NCBI Official Symbol
IFNAR2
NCBI Official Synonym Symbols
IFN-R; IMD45; IFNABR; IFNARB; IFN-alpha-REC
NCBI Protein Information
interferon alpha/beta receptor 2
UniProt Protein Name
Interferon alpha/beta receptor 2
UniProt Gene Name
IFNAR2
UniProt Synonym Gene Names
IFNABR; IFNARB; IFN-R-2; IFN-alpha binding protein; IFN-alpha/beta receptor 2
UniProt Entry Name
INAR2_HUMAN

NCBI Description

The protein encoded by this gene is a type I membrane protein that forms one of the two chains of a receptor for interferons alpha and beta. Binding and activation of the receptor stimulates Janus protein kinases, which in turn phosphorylate several proteins, including STAT1 and STAT2. Multiple transcript variants encoding at least two different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]

Uniprot Description

IFNAR2: Associates with IFNAR1 to form the type I interferon receptor. Receptor for interferons alpha and beta. Involved in IFN-mediated STAT1, STAT2 and STAT3 activation. Isoform 1 and isoform 2 are directly involved in signal transduction due to their association with the TYR kinase, JAK1. Isoform 3 is a potent inhibitor of type I IFN receptor activity. Belongs to the type II cytokine receptor family. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Membrane protein, integral; Receptor, cytokine

Chromosomal Location of Human Ortholog: 21q22.11

Cellular Component: extracellular region; integral to plasma membrane; plasma membrane

Molecular Function: interferon-alpha/beta receptor activity; interleukin-20 binding; protein binding; protein kinase binding

Biological Process: cell surface receptor linked signal transduction; defense response to virus; JAK-STAT cascade; response to virus

Disease: Hepatitis B Virus, Susceptibility To; Immunodeficiency 45

Research Articles on IFNAR2

Similar Products

Product Notes

The IFNAR2 ifnar2 (Catalog #AAA1278554) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcttttga gccagaatgc cttcatcgtc agatcactta atttggttct catggtgtat atcagcctcg tgtttggtat ttcatatgat tcgcctgatt acacagatga atcttgcact ttcaagatat cattgcgaaa tttccggtcc atcttatcat gggaattaaa aaaccactcc attgtaccaa ctcactatac attgctgtat acaatcatga gtaaaccaga agatttgaag gtggttaaga actgtgcaaa taccacaaga tcattttgtg acctcacaga tgagtggaga agcacacacg aggcctatgt caccgtccta gaaggattca gcgggaacac aacgttgttc agttgctcac acaatttctg gctggccata gacatgtctt ttgaaccacc agagtttgag attgttggtt ttaccaacca cattaatgtg atggtgaaat ttccatctat tgttgaggaa gaattacagt ttgatttatc tctcgtcatt gaagaacagt cagagggaat tgttaagaag cataaacccg aaataaaagg aaacatgagt ggaaatttca cctatatcat tgacaagtta attccaaaca cgaactactg tgtatctgtt tatttagagc acagtgatga gcaagcagta ataaagtctc ccttaaaatg caccctcctt ccacctggcc aggaatcaga atcagcagaa tctgccaaaa taggaggaat aattactgtg tttttgatag cattggtctt gacaagcacc atagtgacac tgaaatggat tggttatata tgcttaagaa atagcctccc caaagtcttg aggcaaggtc tcactaaggg ctggaatgca gtggctattc acaggtgcag tcataatgca ctacagtctg aaactcctga gctcaaacag tcgtcctgcc taagcttccc cagtagctgg gattacaagc gtgcatccct gtgccccagt gattaa. It is sometimes possible for the material contained within the vial of "IFNAR2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.