Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

FYCO1 cdna clone

FYCO1 cDNA Clone

Gene Names
FYCO1; CATC2; RUFY3; ZFYVE7; CTRCT18
Synonyms
FYCO1; FYCO1 cDNA Clone; FYCO1 cdna clone
Ordering
For Research Use Only!
Sequence
atgaacaccaaagtgaccagtgactggtactatgcaagaagcccctttctgcagccaaagctgagctcggacattgtgggccaactctatgagctgactgaggttcagtttgacctggcgtcgaggggctttgacttggatgctgcctggccaacatttgccaggaggacgctgaccactggctcttctgcttacctgtggaaaccccctagccgcagctccagcatgagcagcttggtgagcagctacctgcagactcaagagatggtgtccaactttgacctgaacagccccctaaacaacgaggcattggagggctttgatgagatgcgactagagctggaccagttggaggtgcgggagaagcagctacaggagcgcatgcagcagctggacagagagaaccaggagctgagggcagctgtcagccagcaaggggagcaactgcagacagagagggagagggggcgcactgcagcggaggacaacgttcgcctcacttgcttggtagctgagctccagaagcagtgggaggtcacccaggccacccagaacactgtgaaggagctgcagacatgcctgcaggccctggagctaggagcagcagagaaggaggaggactaccacacagccctgcggcggctggagtccatgctgcagcccttggcacaggagcttgaggccacacgggactcactggacaagaaaaaccagcatttagccagcttcccaggctggctagccatggccctgcatgttggagactga
Sequence Length
768
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
168,888 Da
NCBI Official Full Name
Homo sapiens FYVE and coiled-coil domain containing 1, mRNA
NCBI Official Synonym Full Names
FYVE and coiled-coil domain containing 1
NCBI Official Symbol
FYCO1
NCBI Official Synonym Symbols
CATC2; RUFY3; ZFYVE7; CTRCT18
NCBI Protein Information
FYVE and coiled-coil domain-containing protein 1
UniProt Protein Name
FYVE and coiled-coil domain-containing protein 1
UniProt Gene Name
FYCO1
UniProt Synonym Gene Names
ZFYVE7
UniProt Entry Name
FYCO1_HUMAN

NCBI Description

This gene encodes a protein that contains a RUN domain, FYVE-type zinc finger domain and Golgi dynamics (GOLD) domain. The encoded protein plays a role in microtubule plus end-directed transport of autophagic vesicles through interactions with the small GTPase Rab7, phosphatidylinositol-3-phosphate (PI3P) and the autophagosome marker LC3. Mutations in this gene are a cause of autosomal recessive congenital cataract-2 (CATC2). [provided by RefSeq, Dec 2011]

Uniprot Description

FYCO1: May mediate microtubule plus end-directed vesicle transport. Defects in FYCO1 are the cause of cataract congenital autosomal recessive type 2 (CATC2). An opacification of the crystalline lens of the eye becoming evident at birth or in infancy. It frequently results in visual impairment or blindness. Opacities vary in morphology, are often confined to a portion of the lens, and may be static or progressive. In general, the more posteriorly located and dense an opacity, the greater the impact on visual function. Pathogenic mutations in FYCO1 can affect intracellular transport of autophagocytic vesicles from the perinuclear area to the periphery, leading to an accumulation of large numbers of vesicles and hence loss of lens transparency (PubMed:21636066). 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Autophagy

Chromosomal Location of Human Ortholog: 3p21.31

Cellular Component: autophagic vacuole; intracellular membrane-bound organelle; late endosome; lysosome; membrane

Molecular Function: protein binding

Disease: Cataract 18

Research Articles on FYCO1

Similar Products

Product Notes

The FYCO1 fyco1 (Catalog #AAA1278541) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaacacca aagtgaccag tgactggtac tatgcaagaa gcccctttct gcagccaaag ctgagctcgg acattgtggg ccaactctat gagctgactg aggttcagtt tgacctggcg tcgaggggct ttgacttgga tgctgcctgg ccaacatttg ccaggaggac gctgaccact ggctcttctg cttacctgtg gaaaccccct agccgcagct ccagcatgag cagcttggtg agcagctacc tgcagactca agagatggtg tccaactttg acctgaacag ccccctaaac aacgaggcat tggagggctt tgatgagatg cgactagagc tggaccagtt ggaggtgcgg gagaagcagc tacaggagcg catgcagcag ctggacagag agaaccagga gctgagggca gctgtcagcc agcaagggga gcaactgcag acagagaggg agagggggcg cactgcagcg gaggacaacg ttcgcctcac ttgcttggta gctgagctcc agaagcagtg ggaggtcacc caggccaccc agaacactgt gaaggagctg cagacatgcc tgcaggccct ggagctagga gcagcagaga aggaggagga ctaccacaca gccctgcggc ggctggagtc catgctgcag cccttggcac aggagcttga ggccacacgg gactcactgg acaagaaaaa ccagcattta gccagcttcc caggctggct agccatggcc ctgcatgttg gagactga. It is sometimes possible for the material contained within the vial of "FYCO1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.