Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PSG6 cdna clone

PSG6 cDNA Clone

Gene Names
PSG6; PSG10; PSGGB; PSBG-6; PSBG-10; PSBG-12
Synonyms
PSG6; PSG6 cDNA Clone; PSG6 cdna clone
Ordering
For Research Use Only!
Sequence
atgggacccctctcagcccctccctgcactcagcacatcacctggaaggggctcctgctcacagcatcacttttaaacttctggaacctgcccaccactgcccaagtaataattgaagccaagccacccaaagtttccgaggggaaggatgttcttctacttgtccacaatttgccccagaatcttactggctacatctggtacaaagggcaaatgacggacctctaccattacattacatcatatgtagtacacggtcaaattatatatgggcctgcctacagtggacgagaaacagtatattccaatgcatccctgctgatccagaatgtcacacaggaggatgcaggatcctacaccttacacatcataaagcgaggcgatgggactggaggagtaactggatatttcactgtcaccttatactcggagactcccaagccctccatctccagcagcaacttaaaccccagggaggtcatggaggctgtgcgcttaatctgtgatcctgagactccggatgcaagctacctgtggttgctgaatggtcagaacctccctatgactcacaggttgcagctgtccaaaaccaacaggaccctctatctatttggtgtcacaaagtatattgcaggaccctatgaatgtgaaatacggaacccagtgagtgccagccgcagtgacccagtcaccctgaatctcctcccgaagctgcccatgccttacatcaccatcaacaacttaaaccccagggagaagaaggatgtgttagccttcacctgtgaacctaagagtcggaactacacctacatttggtggctaaatggtcagagcctcccggtcagtccgagggtaaagcgacccattgaaaacaggatactcattctacccagtgtcacgagaaatgaaacaggaccctatcaatgtgaaatacgggaccgatatggtggcatccgcagtaacccagtcaccctgaatgtcctctatggtccagacctccccagaatttacccttcattcacctattaccgttcaggagaaaacctcgacttgtcctgctttgcggactctaacccaccggcagagtattcttggacaattaatgggaagtttcagctatcaggacaaaagctctttatcccccaaattactacaaatcatagcgggctctatgcttgctctgttcgtaactcagccactggcaaggaaatctccaaatccatgatagtcaaagtctctggtccctgccatggaaaccagacagagtctcattaa
Sequence Length
1275
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
47,501 Da
NCBI Official Full Name
Homo sapiens pregnancy specific beta-1-glycoprotein 6, mRNA
NCBI Official Synonym Full Names
pregnancy specific beta-1-glycoprotein 6
NCBI Official Symbol
PSG6
NCBI Official Synonym Symbols
PSG10; PSGGB; PSBG-6; PSBG-10; PSBG-12
NCBI Protein Information
pregnancy-specific beta-1-glycoprotein 6
UniProt Protein Name
Pregnancy-specific beta-1-glycoprotein 6
UniProt Gene Name
PSG6
UniProt Synonym Gene Names
CGM3; PSG10; PSG12; PSGGB; PS-beta-G-6; PSBG-6; Pregnancy-specific glycoprotein 6; PS-beta-G-10; PSBG-10; Pregnancy-specific glycoprotein 10; PS-beta-G-12; PSBG-12; Pregnancy-specific glycoprotein 12
UniProt Entry Name
PSG6_HUMAN

NCBI Description

This gene is a member of the pregnancy-specific glycoprotein (PSG) gene family. The PSG genes are a subgroup of the carcinoembryonic antigen (CEA) family of immunoglobulin-like genes, and are found in a gene cluster at 19q13.1-q13.2 telomeric to another cluster of CEA-related genes. The PSG genes are expressed by placental trophoblasts and released into the maternal circulation during pregnancy, and are thought to be essential for maintenance of normal pregnancy. The protein encoded by this gene contains the Arg-Gly-Asp tripeptide associated with cellular adhesion and recognition. Alternative splicing results in multiple transcript variants and protein isoforms. [provided by RefSeq, Jul 2012]

Uniprot Description

PSG6: a member of the pregnancy-specific glycoprotein (PSG) gene family. The PSG genes are a subgroup of the carcinoembryonic antigen (CEA) family of immunoglobulin-like genes, and are found in a gene cluster at 19q13.1-q13.2 telomeric to another cluster of CEA-related genes. The PSG genes are expressed by placental trophoblasts and released into the maternal circulation during pregnancy, and are thought to be essential for maintenance of normal pregnancy. The protein encoded by this gene contains the Arg-Gly-Asp tripeptide associated with cellular adhesion and recognition. Alternative splicing results in multiple transcript variants and protein isoforms. [provided by RefSeq, Jul 2012]

Protein type: Secreted, signal peptide; Secreted

Chromosomal Location of Human Ortholog: 19q13.2

Similar Products

Product Notes

The PSG6 psg6 (Catalog #AAA1278488) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggacccc tctcagcccc tccctgcact cagcacatca cctggaaggg gctcctgctc acagcatcac ttttaaactt ctggaacctg cccaccactg cccaagtaat aattgaagcc aagccaccca aagtttccga ggggaaggat gttcttctac ttgtccacaa tttgccccag aatcttactg gctacatctg gtacaaaggg caaatgacgg acctctacca ttacattaca tcatatgtag tacacggtca aattatatat gggcctgcct acagtggacg agaaacagta tattccaatg catccctgct gatccagaat gtcacacagg aggatgcagg atcctacacc ttacacatca taaagcgagg cgatgggact ggaggagtaa ctggatattt cactgtcacc ttatactcgg agactcccaa gccctccatc tccagcagca acttaaaccc cagggaggtc atggaggctg tgcgcttaat ctgtgatcct gagactccgg atgcaagcta cctgtggttg ctgaatggtc agaacctccc tatgactcac aggttgcagc tgtccaaaac caacaggacc ctctatctat ttggtgtcac aaagtatatt gcaggaccct atgaatgtga aatacggaac ccagtgagtg ccagccgcag tgacccagtc accctgaatc tcctcccgaa gctgcccatg ccttacatca ccatcaacaa cttaaacccc agggagaaga aggatgtgtt agccttcacc tgtgaaccta agagtcggaa ctacacctac atttggtggc taaatggtca gagcctcccg gtcagtccga gggtaaagcg acccattgaa aacaggatac tcattctacc cagtgtcacg agaaatgaaa caggacccta tcaatgtgaa atacgggacc gatatggtgg catccgcagt aacccagtca ccctgaatgt cctctatggt ccagacctcc ccagaattta cccttcattc acctattacc gttcaggaga aaacctcgac ttgtcctgct ttgcggactc taacccaccg gcagagtatt cttggacaat taatgggaag tttcagctat caggacaaaa gctctttatc ccccaaatta ctacaaatca tagcgggctc tatgcttgct ctgttcgtaa ctcagccact ggcaaggaaa tctccaaatc catgatagtc aaagtctctg gtccctgcca tggaaaccag acagagtctc attaa. It is sometimes possible for the material contained within the vial of "PSG6, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.