Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PHF6 cdna clone

PHF6 cDNA Clone

Gene Names
PHF6; BFLS; BORJ; CENP-31
Synonyms
PHF6; PHF6 cDNA Clone; PHF6 cdna clone
Ordering
For Research Use Only!
Sequence
atgtcaagctcagttgaacagaaaaaagggcctacaagacagcgcaaatgtggcttttgtaagtcaaatagagacaaggaatgtggacagttactaatatctgaaaaccagaaggtggcagcgcaccataagtgcatgctcttttcatctgctttggtatcatcacactctgataatgaaagtcttggtggattttctattgaagatgtccaaaaggaaattaaaagaggcacgaagctgatgtgttctttgtgccattgtcctggagcaacaattggttgtgatgtgaaaacatgtcacaggacataccactaccactgtgcattgcatgataaagctcaaatacgagagaaaccttcacaaggaatttacatggcctattgccgaaaacacaagaaaactgcacataactccgaagcagctgatttagaagaaagttttaatgaacatgaactggagccctcatcacctaaaagtaaaaagaaaagtcgcaaaggaaggccaagaaaaactaattttaaagggctgtcagaagataccaggtccacatcctcccatggaacagatgaaatggaaagtagttcctatagagataggtctccacacagaagcagccctagtgacaccaggcctaaatgtggattttgccatgtaggggaggaagaaaatgaagcacgaggaaaactgcatatatttaatgccaagaaggcagctgcccattataagtgcatgttgttttcttctggcacagtccagctcacaacaacatcaagagcagaatttggagactttgatattaaaactgtacttcaggagattaaacgaggaaaaagaatggtctgtagtttttatatttgttatgcaacattacacttgatttgctgctttaaatttagagtacatcccaaatttatccagtcatcagaaaatttaaagtag
Sequence Length
939
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
37,628 Da
NCBI Official Full Name
Homo sapiens PHD finger protein 6, mRNA
NCBI Official Synonym Full Names
PHD finger protein 6
NCBI Official Symbol
PHF6
NCBI Official Synonym Symbols
BFLS; BORJ; CENP-31
NCBI Protein Information
PHD finger protein 6
UniProt Protein Name
PHD finger protein 6
Protein Family
UniProt Gene Name
PHF6
UniProt Synonym Gene Names
CENP-31; KIAA1823
UniProt Entry Name
PHF6_HUMAN

NCBI Description

This gene is a member of the plant homeodomain (PHD)-like finger (PHF) family. It encodes a protein with two PHD-type zinc finger domains, indicating a potential role in transcriptional regulation, that localizes to the nucleolus. Mutations affecting the coding region of this gene or the splicing of the transcript have been associated with Borjeson-Forssman-Lehmann syndrome (BFLS), a disorder characterized by mental retardation, epilepsy, hypogonadism, hypometabolism, obesity, swelling of subcutaneous tissue of the face, narrow palpebral fissures, and large ears. Alternate splicing results in multiple transcript variants, encoding different isoforms. [provided by RefSeq, Jun 2010]

Uniprot Description

PHF6: May play a role in transcriptional regulation. Defects in PHF6 are the cause of Boerjeson-Forssman- Lehmann syndrome (BFLS); also known as Boerjeson- Forssman syndrome (BORJ). BFLS is a X-linked recessive disorder characterized by moderate to severe mental retardation, epilepsy, hypogonadism, hypometabolism, obesity with marked gynecomastia, swelling of subcutaneous tissue of the face, narrow palpebral fissure and large but not deformed ears. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Nucleolus; Unknown function

Chromosomal Location of Human Ortholog: Xq26.3

Cellular Component: nucleolus; nucleoplasm; nucleus

Molecular Function: enzyme binding; histone binding; histone deacetylase binding; phosphoprotein binding; protein binding; ribonucleoprotein binding; tubulin binding

Disease: Borjeson-forssman-lehmann Syndrome

Research Articles on PHF6

Similar Products

Product Notes

The PHF6 phf6 (Catalog #AAA1278427) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtcaagct cagttgaaca gaaaaaaggg cctacaagac agcgcaaatg tggcttttgt aagtcaaata gagacaagga atgtggacag ttactaatat ctgaaaacca gaaggtggca gcgcaccata agtgcatgct cttttcatct gctttggtat catcacactc tgataatgaa agtcttggtg gattttctat tgaagatgtc caaaaggaaa ttaaaagagg cacgaagctg atgtgttctt tgtgccattg tcctggagca acaattggtt gtgatgtgaa aacatgtcac aggacatacc actaccactg tgcattgcat gataaagctc aaatacgaga gaaaccttca caaggaattt acatggccta ttgccgaaaa cacaagaaaa ctgcacataa ctccgaagca gctgatttag aagaaagttt taatgaacat gaactggagc cctcatcacc taaaagtaaa aagaaaagtc gcaaaggaag gccaagaaaa actaatttta aagggctgtc agaagatacc aggtccacat cctcccatgg aacagatgaa atggaaagta gttcctatag agataggtct ccacacagaa gcagccctag tgacaccagg cctaaatgtg gattttgcca tgtaggggag gaagaaaatg aagcacgagg aaaactgcat atatttaatg ccaagaaggc agctgcccat tataagtgca tgttgttttc ttctggcaca gtccagctca caacaacatc aagagcagaa tttggagact ttgatattaa aactgtactt caggagatta aacgaggaaa aagaatggtc tgtagttttt atatttgtta tgcaacatta cacttgattt gctgctttaa atttagagta catcccaaat ttatccagtc atcagaaaat ttaaagtag. It is sometimes possible for the material contained within the vial of "PHF6, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.