Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

MED1 cdna clone

MED1 cDNA Clone

Gene Names
MED1; PBP; CRSP1; RB18A; TRIP2; PPARBP; CRSP200; DRIP205; DRIP230; PPARGBP; TRAP220
Synonyms
MED1; MED1 cDNA Clone; MED1 cdna clone
Ordering
For Research Use Only!
Sequence
atgaaagctcagggggaaaccgaggagtcagaaaagctgagtaagatgagttctctcctggaacggctccatgcaaaatttaaccaaaatagaccctggagtgaaaccattaagcttgtgcgtcaagtcatggagaagagggttgtgatgagttctggagggcatcaacatttggtcagctgtttggagacattgcagaaggctctcaaagtaacatctttaccagcaatgactgatcgtttggagtccatagcaagacagaatggactgggctctcatctcagtgccagtggcactgaatgttacatcacgtcagatatgttctatgtggaagtgcagttagatcctgcaggacagctttgtgatgtaaaagtggctcaccatggggagaatcctgtgagctgtccggagcttgtacagcagctaagggaaaaaaattttgatgaattttctaagcaccttaagggccttgttaatctgtataaccttccaggggacaacaaactgaagactaaaatgtacttggctctccaatccttagaacaagatctttctaaaatggcaattatgtactggaaagcaactaatgctggtcccttggataagattcttcatggaagtgttggctatctcacaccaaggagtgggggtcatttaatgaacctgaagtactatgtctctccttctgacctactggatgacaagactgcatctcccatcattttgcatgagaataatgtttctcgatctttgggcatgaatgcatcagtgacaattgaaggaacatctgctgtgtacaaactcccaattgcaccattaattatggggtcacatccagttgacaataaatggaccccttccttctcctcaatcaccagtgccaacagtgttgatcttcctgcctgtttcttcttgaaatttccccagccaatcccagtatctagagcatttgttcagaaactgcagaactgcacaggaattccattgtttgaaactcaaccaacttatgcacccctgtatgaactgatcactcagtttgagctatcaaaggaccctgaccccatacctttgaatcacaacatgagattttatgctgctcttcctggtcagcagcactgctatttcctcaacaaggatgctcctcttccagatggccgaagtctacagggaacccttgttagcaaaatcacctttcagcaccctggccgagttcctcttatcctaaatctgatcagacaccaagtggcctataacaccctcattggaagctgtgtcaaaagaactattctgaaagaagattctcctgggcttctccaatttgaagtgtgtcctctctcagagtctcgtttcagcgtatcttttcagcaccctgtgaatgactccctggtgtgtgtggtaatggatgtgcaggactcaacacatgtgagctgtaaactctacaaagggctgtcggatgcactgatctgcacagatgacttcattgccaaagttgttcaaagatgtatgtccatccctgtgacgatgagggctattcggaggaaagctgaaaccattcaagccgacaccccagcactgtccctcattgcagagacagttgaagacatggtgaaaaagaacctgcccccggctagcagcccaggatcaaagaatcccgagttaggatctggatga
Sequence Length
1671
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
61,563 Da
NCBI Official Full Name
Homo sapiens mediator complex subunit 1, mRNA
NCBI Official Synonym Full Names
mediator complex subunit 1
NCBI Official Symbol
MED1
NCBI Official Synonym Symbols
PBP; CRSP1; RB18A; TRIP2; PPARBP; CRSP200; DRIP205; DRIP230; PPARGBP; TRAP220
NCBI Protein Information
mediator of RNA polymerase II transcription subunit 1
UniProt Protein Name
Mediator of RNA polymerase II transcription subunit 1
UniProt Gene Name
MED1
UniProt Synonym Gene Names
ARC205; CRSP1; CRSP200; DRIP205; DRIP230; PBP; PPARBP; PPARGBP; RB18A; TRAP220; TRIP2; ARC205; PBP; PPAR-binding protein; Trap220; TR-interacting protein 2; TRIP-2
UniProt Entry Name
MED1_HUMAN

NCBI Description

The activation of gene transcription is a multistep process that is triggered by factors that recognize transcriptional enhancer sites in DNA. These factors work with co-activators to direct transcriptional initiation by the RNA polymerase II apparatus. The protein encoded by this gene is a subunit of the CRSP (cofactor required for SP1 activation) complex, which, along with TFIID, is required for efficient activation by SP1. This protein is also a component of other multisubunit complexes e.g. thyroid hormone receptor-(TR-) associated proteins which interact with TR and facilitate TR function on DNA templates in conjunction with initiation factors and cofactors. It also regulates p53-dependent apoptosis and it is essential for adipogenesis. This protein is known to have the ability to self-oligomerize. [provided by RefSeq, Jul 2008]

Uniprot Description

MED1: a subunit of the CRSP (cofactor required for SP1 activation) complex, which, along with TFIID, is required for efficient activation by SP1. Also is a component of other multisubunit complexes e.g. thyroid hormone receptor- (TR-) associated proteins which interact with TR and facilitate TR function on DNA templates in conjunction with initiation factors and cofactors. May regulates p53-dependent apoptosis. Is essential for adipogenesis. This protein is known to have the ability to self-oligomerize. Two splice-variant isoforms have been described.

Protein type: Nuclear receptor co-regulator; Transcription, coactivator/corepressor

Chromosomal Location of Human Ortholog: 17q12

Cellular Component: membrane; nucleolus; nucleoplasm; nucleus; Srb-mediator complex

Molecular Function: chromatin binding; estrogen receptor binding; LBD domain binding; ligand-dependent nuclear receptor binding; ligand-dependent nuclear receptor transcription coactivator activity; nuclear hormone receptor binding; peroxisome proliferator activated receptor binding; protein binding; receptor activity; retinoic acid receptor binding; thyroid hormone receptor binding; thyroid hormone receptor coactivator activity; transcription coactivator activity; transcription cofactor activity; transcription factor binding; vitamin D receptor binding

Biological Process: androgen biosynthetic process; androgen receptor signaling pathway; angiogenesis; cell morphogenesis; cellular lipid metabolic process; erythrocyte development; fat cell differentiation; keratinocyte differentiation; lens development in camera-type eye; mRNA transcription from RNA polymerase II promoter; negative regulation of apoptosis; negative regulation of neuron differentiation; negative regulation of transcription from RNA polymerase II promoter; positive regulation of erythrocyte differentiation; positive regulation of keratinocyte differentiation; positive regulation of transcription from RNA polymerase II promoter; positive regulation of transcription, DNA-dependent; regulation of transcription from RNA polymerase I promoter; steroid hormone receptor signaling pathway; transcription initiation from RNA polymerase II promoter

Research Articles on MED1

Similar Products

Product Notes

The MED1 med1 (Catalog #AAA1278426) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaaagctc agggggaaac cgaggagtca gaaaagctga gtaagatgag ttctctcctg gaacggctcc atgcaaaatt taaccaaaat agaccctgga gtgaaaccat taagcttgtg cgtcaagtca tggagaagag ggttgtgatg agttctggag ggcatcaaca tttggtcagc tgtttggaga cattgcagaa ggctctcaaa gtaacatctt taccagcaat gactgatcgt ttggagtcca tagcaagaca gaatggactg ggctctcatc tcagtgccag tggcactgaa tgttacatca cgtcagatat gttctatgtg gaagtgcagt tagatcctgc aggacagctt tgtgatgtaa aagtggctca ccatggggag aatcctgtga gctgtccgga gcttgtacag cagctaaggg aaaaaaattt tgatgaattt tctaagcacc ttaagggcct tgttaatctg tataaccttc caggggacaa caaactgaag actaaaatgt acttggctct ccaatcctta gaacaagatc tttctaaaat ggcaattatg tactggaaag caactaatgc tggtcccttg gataagattc ttcatggaag tgttggctat ctcacaccaa ggagtggggg tcatttaatg aacctgaagt actatgtctc tccttctgac ctactggatg acaagactgc atctcccatc attttgcatg agaataatgt ttctcgatct ttgggcatga atgcatcagt gacaattgaa ggaacatctg ctgtgtacaa actcccaatt gcaccattaa ttatggggtc acatccagtt gacaataaat ggaccccttc cttctcctca atcaccagtg ccaacagtgt tgatcttcct gcctgtttct tcttgaaatt tccccagcca atcccagtat ctagagcatt tgttcagaaa ctgcagaact gcacaggaat tccattgttt gaaactcaac caacttatgc acccctgtat gaactgatca ctcagtttga gctatcaaag gaccctgacc ccataccttt gaatcacaac atgagatttt atgctgctct tcctggtcag cagcactgct atttcctcaa caaggatgct cctcttccag atggccgaag tctacaggga acccttgtta gcaaaatcac ctttcagcac cctggccgag ttcctcttat cctaaatctg atcagacacc aagtggccta taacaccctc attggaagct gtgtcaaaag aactattctg aaagaagatt ctcctgggct tctccaattt gaagtgtgtc ctctctcaga gtctcgtttc agcgtatctt ttcagcaccc tgtgaatgac tccctggtgt gtgtggtaat ggatgtgcag gactcaacac atgtgagctg taaactctac aaagggctgt cggatgcact gatctgcaca gatgacttca ttgccaaagt tgttcaaaga tgtatgtcca tccctgtgac gatgagggct attcggagga aagctgaaac cattcaagcc gacaccccag cactgtccct cattgcagag acagttgaag acatggtgaa aaagaacctg cccccggcta gcagcccagg atcaaagaat cccgagttag gatctggatg a. It is sometimes possible for the material contained within the vial of "MED1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.