Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

C9 cdna clone

C9 cDNA Clone

Gene Names
C9; C9D; ARMD15
Synonyms
C9; C9 cDNA Clone; C9 cdna clone
Ordering
For Research Use Only!
Sequence
atgtcagcctgccggagctttgcagttgcaatctgcattttagaaataagcatcctcacagcacagtacacgaccagttatgacccagagctaacagaaagcagtggctctgcatcacacatagactgcagaatgagcccctggagtgaatggtcacaatgcgatccttgtctcagacaaatgtttcgttcaagaagcattgaggtctttggacaatttaatgggaaaagatgcaccgacgctgtgggagacagacgacagtgtgtgcccacagagccctgtgaggatgctgaggatgactgcggaaatgactttcaatgcagtacaggcagatgcataaagatgcgacttcggtgtaatggtgacaatgactgcggagacttttcagatgaggatgattgtgaaagtgagccccgtcccccctgcagagacagagtggtagaagagtctgagctggcacgaacagcaggctatgggatcaacattttagggatggatcccctaagcacaccttttgacaatgagttctacaatggactctgtaaccgggatcgggatggaaacactctgacatactaccgaagaccttggaacgtggcttctttgatctatgaaaccaaaggcgagaaaaatttcagaaccgaacattacgaagaacaaattgaagcatttaaaagtatcatccaagagaagacatcaaattttaatgcagctatatctctaaaatttacacccactgaaacaaataaagctgaacaatgttgtgaggaaacagcctcctcaatttctttacatggcaagggtagttttcggttttcatattccaaaaatgaaacttaccaactatttttgtcatattcttcaaagaaggaaaaaatgtttctgcatgtgaaaggagaaattcatctgggaagatttgtaatgagaaatcgcgatgttgtgctcacaacaacttttgtggatgatataaaagctttgccaactacctatgaaaagggagaatattttgcctttttggaaacctatggaactcactacagtagctctgggtctctaggaggactctatgaactaatatatgttttggataaagcttccatgaagcggaaaggtgttgaactaaaagacataaagagatgccttgggtatcatctggatgtatctctggctttctctgaaatctctgttggagctgaatttaataaagatgattgtgtaaagaggggagagggtagagctgtaaacatcaccagtgaaaacctcatagatgatgttgtttcactcataagaggtggaaccagaaaatatgcatttgaactgaaagaaaagcttctccgaggaaccgtgattgatgtgactgactttgtcaactgggcctcttccataaatgatgctcctgttctcattagtcaaaaactgtctcctatatataatctggttccagtgaaaatgaaaaatgcacacctaaagaaacaaaacttggaaagagccattgaagactatatcaatgaatttagtgtaagaaaatgccacacatgccaaaatggaggtacagtgattctaatggatggaaagtgtttgtgtgcctgcccattcaaatttgagggaattgcctgtgaaatcagtaaacaaaaaatttctgaaggattgccagccctagagttccccaatgaaaaatag
Sequence Length
1680
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
735
Molecular Weight
63,173 Da
NCBI Official Full Name
Homo sapiens complement component 9, mRNA
NCBI Official Synonym Full Names
complement C9
NCBI Official Symbol
C9
NCBI Official Synonym Symbols
C9D; ARMD15
NCBI Protein Information
complement component C9
UniProt Protein Name
Complement component C9
Protein Family
UniProt Gene Name
C9
UniProt Entry Name
CO9_HUMAN

NCBI Description

This gene encodes the final component of the complement system. It participates in the formation of the Membrane Attack Complex (MAC). The MAC assembles on bacterial membranes to form a pore, permitting disruption of bacterial membrane organization. Mutations in this gene cause component C9 deficiency. [provided by RefSeq, Feb 2009]

Uniprot Description

C9: Constituent of the membrane attack complex (MAC) that plays a key role in the innate and adaptive immune response by forming pores in the plasma membrane of target cells. C9 is the pore-forming subunit of the MAC. Defects in C9 are a cause of complement component 9 deficiency (C9D). A rare defect of the complement classical pathway associated with susceptibility to severe recurrent infections, predominantly by Neisseria gonorrhoeae or Neisseria meningitidis. Belongs to the complement C6/C7/C8/C9 family.

Protein type: Extracellular matrix; Membrane protein, multi-pass; Apoptosis; Membrane protein, integral

Chromosomal Location of Human Ortholog: 5p14-p12

Cellular Component: cytoplasm; extracellular region; integral to plasma membrane; plasma membrane

Biological Process: hemolysis by symbiont of host red blood cells; regulation of complement activation

Disease: Complement Component 9 Deficiency; Macular Degeneration, Age-related, 15

Research Articles on C9

Similar Products

Product Notes

The C9 c9 (Catalog #AAA1278424) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtcagcct gccggagctt tgcagttgca atctgcattt tagaaataag catcctcaca gcacagtaca cgaccagtta tgacccagag ctaacagaaa gcagtggctc tgcatcacac atagactgca gaatgagccc ctggagtgaa tggtcacaat gcgatccttg tctcagacaa atgtttcgtt caagaagcat tgaggtcttt ggacaattta atgggaaaag atgcaccgac gctgtgggag acagacgaca gtgtgtgccc acagagccct gtgaggatgc tgaggatgac tgcggaaatg actttcaatg cagtacaggc agatgcataa agatgcgact tcggtgtaat ggtgacaatg actgcggaga cttttcagat gaggatgatt gtgaaagtga gccccgtccc ccctgcagag acagagtggt agaagagtct gagctggcac gaacagcagg ctatgggatc aacattttag ggatggatcc cctaagcaca ccttttgaca atgagttcta caatggactc tgtaaccggg atcgggatgg aaacactctg acatactacc gaagaccttg gaacgtggct tctttgatct atgaaaccaa aggcgagaaa aatttcagaa ccgaacatta cgaagaacaa attgaagcat ttaaaagtat catccaagag aagacatcaa attttaatgc agctatatct ctaaaattta cacccactga aacaaataaa gctgaacaat gttgtgagga aacagcctcc tcaatttctt tacatggcaa gggtagtttt cggttttcat attccaaaaa tgaaacttac caactatttt tgtcatattc ttcaaagaag gaaaaaatgt ttctgcatgt gaaaggagaa attcatctgg gaagatttgt aatgagaaat cgcgatgttg tgctcacaac aacttttgtg gatgatataa aagctttgcc aactacctat gaaaagggag aatattttgc ctttttggaa acctatggaa ctcactacag tagctctggg tctctaggag gactctatga actaatatat gttttggata aagcttccat gaagcggaaa ggtgttgaac taaaagacat aaagagatgc cttgggtatc atctggatgt atctctggct ttctctgaaa tctctgttgg agctgaattt aataaagatg attgtgtaaa gaggggagag ggtagagctg taaacatcac cagtgaaaac ctcatagatg atgttgtttc actcataaga ggtggaacca gaaaatatgc atttgaactg aaagaaaagc ttctccgagg aaccgtgatt gatgtgactg actttgtcaa ctgggcctct tccataaatg atgctcctgt tctcattagt caaaaactgt ctcctatata taatctggtt ccagtgaaaa tgaaaaatgc acacctaaag aaacaaaact tggaaagagc cattgaagac tatatcaatg aatttagtgt aagaaaatgc cacacatgcc aaaatggagg tacagtgatt ctaatggatg gaaagtgttt gtgtgcctgc ccattcaaat ttgagggaat tgcctgtgaa atcagtaaac aaaaaatttc tgaaggattg ccagccctag agttccccaa tgaaaaatag. It is sometimes possible for the material contained within the vial of "C9, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.