Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

DDX21 cdna clone

DDX21 cDNA Clone

Gene Names
DDX21; GUA; GURDB; RH-II/GU; RH-II/GuA
Synonyms
DDX21; DDX21 cDNA Clone; DDX21 cdna clone
Ordering
For Research Use Only!
Sequence
atgccgggaaaactccgtagtgacgctggtttggaatcagacaccgcaatgaaaaaaggggagacactgcgaaagcaaaccgaggagaaagagaaaaaagagaagccaaaatctgataagactgaagagatagcagaagaggaagaaactgttttccccaaagctaaacaagttaaaaagaaagcagagccttctgaagttgacatgaattctcctaaatccaaaaaggcaaaaaagaaagaggagccatctcaaaatgacatttctcctaaaaccaaaagtttgagaaagaaaaaggagcccattgaaaagaaagtggtttcttctaaaaccaaaaaagtgacaaaaaatgaggagccttctgaggaagaaatagatgctcctaagcccaagaagatgaagaaagaaaaggaaatgaatggagaaactagagagaaaagccccaaactgaagaatggatttcctcatcctgaaccggactgtaaccccagtgaagctgccagtgaagaaagtaacagtgagatagagcaggaaatacctgtggaacaaaaagaaggcgctttctctaattttcccatatctgaagaaactattaaacttctcaaaggccgaggagtgaccttcctatttcctatacaagcaaagacattccatcatgtttacagcgggaaggacttaattgcacaggcacggacaggaactgggaagacattctcctttgccatccctttgattgagaaacttcatggggaactgcaagacaggaagagaggccgtgcccctcaggtactggttcttgcacctacaagagagttggcaaatcaagtaagcaaagacttcagtgacatcacaaaaaagctgtcagtggcttgtttttatggtggaactccctatggaggtcaatttgaacgcatgaggaatgggattgatatcctggttggaacaccaggtcgtatcaaagaccacatacagaatggcaaactagatctcaccaaacttaagcatgttgtcctggatgaagtggaccagatgttggatatgggatttgctgatcaagtggaagagattttaagtgtggcatacaagaaagattctgaagacaatccccaaacattgcttttttctgcaacttgccctcattgggtatttaatgttgccaagaaatacatgaaatctacatatgaacaggtggacctgattggtaaaaagactcagaaaacggcaataactgtggagcatctggctattaagtgccactggactcagagggcagcagttattggggatgtcatccgagtatatagtggtcatcaaggacgcactatcatcttttgtgaaaccaagaaagaagcccaggagctgtcccagaattcagctataaagcaggatgctcagtccttgcatggagacattccacagaagcaaagggaaatcaccctgaaaggttttagaaatggtagttttggagttttggtggcaaccaatgttgctgcacgtgggttagacatccctgaggttgatttggttatacaaagctctccaccaaaggatgtagagtcctacattcatcgatccgggcggacaggcagagctggaaggacgggggtgtgcatctgcttttatcagcacaaggaagaatatcagttagtacaagtggagcaaaaagcgggaattaagttcaaacgaataggtgttccttctgcaacagaaataataaaagcttccagcaaagatgccatcaggcttttggattccgtgcctcccactgccattagtcacttcaaacaatcagctgagaagctgatagaggagaagggagctgtggaagctctggcagcagcactggcccatatttcaggtgccacgtccgtagaccagcgctccttgatcaactcaaatgtgggttttgtgaccatgatcttgcagtgctcaattgaaatgccaaatattagttatgcttggaaagaacttaaagagcagctgggcgaggagattgattccaaagtgaagggaatggtttttctcaaaggaaagctgggtgtttgctttgatgtacctaccgcatcagtaacagaaatacaggagaaatggcatgattcacgacgctggcagctctctgtggccacagagcaaccagaactggaaggaccacgggaaggatatggaggcttcaggggacagcgggaaggcagtcgaggcttcaggggacagcgggacggaaacagaagattcagaggacagcgggaaggcagtagaggcccgagaggacagcgatcaggaggtggcaacaaaagtaacagatcccaaaacaaaggccagaagcggagtttcagtaaagcatttggtcaataa
Sequence Length
2352
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
79,657 Da
NCBI Official Full Name
Homo sapiens DEAD (Asp-Glu-Ala-Asp) box polypeptide 21, mRNA
NCBI Official Synonym Full Names
DEAD-box helicase 21
NCBI Official Symbol
DDX21
NCBI Official Synonym Symbols
GUA; GURDB; RH-II/GU; RH-II/GuA
NCBI Protein Information
nucleolar RNA helicase 2
UniProt Protein Name
Nucleolar RNA helicase 2
Protein Family
UniProt Gene Name
DDX21
UniProt Entry Name
DDX21_HUMAN

NCBI Description

DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a DEAD box protein, which is an antigen recognized by autoimmune antibodies from a patient with watermelon stomach disease. This protein unwinds double-stranded RNA, folds single-stranded RNA, and may play important roles in ribosomal RNA biogenesis, RNA editing, RNA transport, and general transcription. [provided by RefSeq, Jul 2008]

Uniprot Description

DDX21: a protein of the DEAD box helicase family. Unwinds double-stranded RNA, folds single-stranded RNA, and may play important roles in ribosomal RNA biogenesis, RNA editing, RNA transport, and general transcription. DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp, are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly.

Protein type: Nucleolus; Helicase; RNA-binding; RNA processing; EC 3.6.4.13

Chromosomal Location of Human Ortholog: 10q21

Cellular Component: membrane; nucleolus; nucleoplasm; nucleus

Molecular Function: ATP-dependent RNA helicase activity; protein binding; rRNA binding; snoRNA binding

Biological Process: osteoblast differentiation; positive regulation of gene expression, epigenetic; RNA secondary structure unwinding; transcription from RNA polymerase II promoter

Research Articles on DDX21

Similar Products

Product Notes

The DDX21 ddx21 (Catalog #AAA1278423) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgccgggaa aactccgtag tgacgctggt ttggaatcag acaccgcaat gaaaaaaggg gagacactgc gaaagcaaac cgaggagaaa gagaaaaaag agaagccaaa atctgataag actgaagaga tagcagaaga ggaagaaact gttttcccca aagctaaaca agttaaaaag aaagcagagc cttctgaagt tgacatgaat tctcctaaat ccaaaaaggc aaaaaagaaa gaggagccat ctcaaaatga catttctcct aaaaccaaaa gtttgagaaa gaaaaaggag cccattgaaa agaaagtggt ttcttctaaa accaaaaaag tgacaaaaaa tgaggagcct tctgaggaag aaatagatgc tcctaagccc aagaagatga agaaagaaaa ggaaatgaat ggagaaacta gagagaaaag ccccaaactg aagaatggat ttcctcatcc tgaaccggac tgtaacccca gtgaagctgc cagtgaagaa agtaacagtg agatagagca ggaaatacct gtggaacaaa aagaaggcgc tttctctaat tttcccatat ctgaagaaac tattaaactt ctcaaaggcc gaggagtgac cttcctattt cctatacaag caaagacatt ccatcatgtt tacagcggga aggacttaat tgcacaggca cggacaggaa ctgggaagac attctccttt gccatccctt tgattgagaa acttcatggg gaactgcaag acaggaagag aggccgtgcc cctcaggtac tggttcttgc acctacaaga gagttggcaa atcaagtaag caaagacttc agtgacatca caaaaaagct gtcagtggct tgtttttatg gtggaactcc ctatggaggt caatttgaac gcatgaggaa tgggattgat atcctggttg gaacaccagg tcgtatcaaa gaccacatac agaatggcaa actagatctc accaaactta agcatgttgt cctggatgaa gtggaccaga tgttggatat gggatttgct gatcaagtgg aagagatttt aagtgtggca tacaagaaag attctgaaga caatccccaa acattgcttt tttctgcaac ttgccctcat tgggtattta atgttgccaa gaaatacatg aaatctacat atgaacaggt ggacctgatt ggtaaaaaga ctcagaaaac ggcaataact gtggagcatc tggctattaa gtgccactgg actcagaggg cagcagttat tggggatgtc atccgagtat atagtggtca tcaaggacgc actatcatct tttgtgaaac caagaaagaa gcccaggagc tgtcccagaa ttcagctata aagcaggatg ctcagtcctt gcatggagac attccacaga agcaaaggga aatcaccctg aaaggtttta gaaatggtag ttttggagtt ttggtggcaa ccaatgttgc tgcacgtggg ttagacatcc ctgaggttga tttggttata caaagctctc caccaaagga tgtagagtcc tacattcatc gatccgggcg gacaggcaga gctggaagga cgggggtgtg catctgcttt tatcagcaca aggaagaata tcagttagta caagtggagc aaaaagcggg aattaagttc aaacgaatag gtgttccttc tgcaacagaa ataataaaag cttccagcaa agatgccatc aggcttttgg attccgtgcc tcccactgcc attagtcact tcaaacaatc agctgagaag ctgatagagg agaagggagc tgtggaagct ctggcagcag cactggccca tatttcaggt gccacgtccg tagaccagcg ctccttgatc aactcaaatg tgggttttgt gaccatgatc ttgcagtgct caattgaaat gccaaatatt agttatgctt ggaaagaact taaagagcag ctgggcgagg agattgattc caaagtgaag ggaatggttt ttctcaaagg aaagctgggt gtttgctttg atgtacctac cgcatcagta acagaaatac aggagaaatg gcatgattca cgacgctggc agctctctgt ggccacagag caaccagaac tggaaggacc acgggaagga tatggaggct tcaggggaca gcgggaaggc agtcgaggct tcaggggaca gcgggacgga aacagaagat tcagaggaca gcgggaaggc agtagaggcc cgagaggaca gcgatcagga ggtggcaaca aaagtaacag atcccaaaac aaaggccaga agcggagttt cagtaaagca tttggtcaat aa. It is sometimes possible for the material contained within the vial of "DDX21, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.