Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CAMP cdna clone

CAMP cDNA Clone

Gene Names
CAMP; LL37; CAP18; CRAMP; HSD26; CAP-18; FALL39; FALL-39
Synonyms
CAMP; CAMP cDNA Clone; CAMP cdna clone
Ordering
For Research Use Only!
Sequence
atgaagacccaaagggatggccactccctggggcggtggtcactggtgctcctgctgctgggcctggtgatgcctctggccatcattgcccaggtcctcagctacaaggaagctgtgcttcgtgctatagatggcatcaaccagcggtcctcggatgctaacctctaccgcctcctggacctggaccccaggcccacgatggatggggacccagacacgccaaagcctgtgagcttcacagtgaaggagacagtgtgccccaggacgacacagcagtcaccagaggattgtgacttcaagaaggacgggctggtgaagcggtgtatggggacagtgaccctcaaccaggccaggggctcctttgacatcagttgtgataaggataacaagagatttgccctgctgggtgatttcttccggaaatctaaagagaagattggcaaagagtttaaaagaattgtccagagaatcaaggattttttgcggaatcttgtacccaggacagagtcctag
Sequence Length
513
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
820
Molecular Weight
19,301 Da
NCBI Official Full Name
Homo sapiens cathelicidin antimicrobial peptide, mRNA
NCBI Official Synonym Full Names
cathelicidin antimicrobial peptide
NCBI Official Symbol
CAMP
NCBI Official Synonym Symbols
LL37; CAP18; CRAMP; HSD26; CAP-18; FALL39; FALL-39
NCBI Protein Information
cathelicidin antimicrobial peptide
UniProt Protein Name
Cathelicidin antimicrobial peptide
Protein Family
UniProt Gene Name
CAMP
UniProt Synonym Gene Names
hCAP-18
UniProt Entry Name
CAMP_HUMAN

NCBI Description

This gene encodes a member of an antimicrobial peptide family, characterized by a highly conserved N-terminal signal peptide containing a cathelin domain and a structurally variable cationic antimicrobial peptide, which is produced by extracellular proteolysis from the C-terminus. In addition to its antibacterial, antifungal, and antiviral activities, the encoded protein functions in cell chemotaxis, immune mediator induction, and inflammatory response regulation. [provided by RefSeq, Sep 2014]

Uniprot Description

CAMP: Binds to bacterial lipopolysaccharides (LPS), has antibacterial activity. Belongs to the cathelicidin family.

Protein type: Cell cycle regulation; Vesicle; Secreted, signal peptide; Secreted

Chromosomal Location of Human Ortholog: 3p21.3

Cellular Component: cell wall; extracellular region; extracellular space; specific granule

Biological Process: antibacterial humoral response; cell redox homeostasis; defense response to bacterium; defense response to Gram-positive bacterium; innate immune response in mucosa; killing by host of symbiont cells

Research Articles on CAMP

Similar Products

Product Notes

The CAMP camp (Catalog #AAA1278297) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaagaccc aaagggatgg ccactccctg gggcggtggt cactggtgct cctgctgctg ggcctggtga tgcctctggc catcattgcc caggtcctca gctacaagga agctgtgctt cgtgctatag atggcatcaa ccagcggtcc tcggatgcta acctctaccg cctcctggac ctggacccca ggcccacgat ggatggggac ccagacacgc caaagcctgt gagcttcaca gtgaaggaga cagtgtgccc caggacgaca cagcagtcac cagaggattg tgacttcaag aaggacgggc tggtgaagcg gtgtatgggg acagtgaccc tcaaccaggc caggggctcc tttgacatca gttgtgataa ggataacaag agatttgccc tgctgggtga tttcttccgg aaatctaaag agaagattgg caaagagttt aaaagaattg tccagagaat caaggatttt ttgcggaatc ttgtacccag gacagagtcc tag. It is sometimes possible for the material contained within the vial of "CAMP, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.