Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SSTR2 cdna clone

SSTR2 cDNA Clone

Synonyms
SSTR2; SSTR2 cDNA Clone; SSTR2 cdna clone
Ordering
For Research Use Only!
Sequence
atggacatggcggatgagccactcaatggaagccacacatggctatccattccatttgacctcaatggctctgtggtgtcaaccaacacctcaaaccagacagagccgtactatgacctgacaagcaatgcagtcctcacattcatctattttgtggtctgcatcattgggttgtgtggcaacacacttgtcatttatgtcatcctccgctatgccaagatgaagaccatcaccaacatttacatcctcaacctggccatcgcagatgagctcttcatgctgggtctgcctttcttggctatgcaggtggctctggtccactggccctttggcaaggccatttgccgggtggtcatgactgtggatggcatcaatcagttcaccagcatcttctgcctgacagtcatgagcatcgaccgatacctggctgtggtccaccccatcaagtcggccaagtggaggagaccccggacggccaagatgatcaccatggctgtgtggggagtctctctgctggtcatcttgcccatcatgatatatgctgggctccggagcaaccagtgggggagaagcagctgcaccatcaactggccaggtgaatctggggcttggtacacagggttcatcatctacactttcattctggggttcctggtacccctcaccatcatctgtctttgctacctgttcattatcatcaaggtgaagtcctctggaatccgagtgggctcctctaagaggaagaagtctgagaagaaggtcacccgaatggtgtccatcgtggtggctgtcttcatcttctgctggcttcccttctacatattcaacgtttcttccgtctccatggccatcagccccaccccagcccttaaaggcatgtttgactttgtggtggtcctcacctatgctaacagctgtgccaaccctatcctatatgccttcttgtctgacaacttcaagaagagcttccagaatgtcctctgcttggtcaaggtgagcggcacagatgatggggagcggagtgacagtaagcaggacaaatcccggctgaatgagaccacggagacccagaggaccctcctcaatggagacctccaaaccagtatctga
Sequence Length
1110
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
40,007 Da
NCBI Official Full Name
Homo sapiens somatostatin receptor 2, mRNA
NCBI Official Synonym Full Names
somatostatin receptor 2
NCBI Official Symbol
SSTR2
NCBI Protein Information
somatostatin receptor type 2
UniProt Protein Name
Somatostatin receptor type 2
Protein Family
UniProt Gene Name
SSTR2
UniProt Synonym Gene Names
SS-2-R; SS2-R; SS2R
UniProt Entry Name
SSR2_HUMAN

NCBI Description

Somatostatin acts at many sites to inhibit the release of many hormones and other secretory proteins. The biologic effects of somatostatin are probably mediated by a family of G protein-coupled receptors that are expressed in a tissue-specific manner. SSTR2 is a member of the superfamily of receptors having seven transmembrane segments and is expressed in highest levels in cerebrum and kidney. [provided by RefSeq, Jul 2008]

Uniprot Description

SSTR2: Receptor for somatostatins-14 and -28. This receptor is coupled via pertussis toxin sensitive G proteins to inhibition of adenylyl cyclase. In addition it stimulates phosphotyrosine phosphatase and PLC via pertussis toxin insensitive as well as sensitive G proteins. In RIN-5F cells, this receptor inhibits calcium entry by suppressing voltage dependent calcium-channels. The C-terminus interacts with SHANK1 PDZ domain. Cerebrum and kidney. In lesser amounts in jejunum, colon and liver. Belongs to the G-protein coupled receptor 1 family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Membrane protein, integral; Membrane protein, multi-pass; GPCR, family 1; Receptor, GPCR

Chromosomal Location of Human Ortholog: 17q24

Cellular Component: integral to plasma membrane; neuron projection; plasma membrane

Molecular Function: neuropeptide binding; PDZ domain binding; protein binding

Biological Process: cell-cell signaling; digestion; G-protein signaling, coupled to cyclic nucleotide second messenger; negative regulation of cell proliferation; response to nutrient; synaptic transmission

Research Articles on SSTR2

Similar Products

Product Notes

The SSTR2 sstr2 (Catalog #AAA1278263) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggacatgg cggatgagcc actcaatgga agccacacat ggctatccat tccatttgac ctcaatggct ctgtggtgtc aaccaacacc tcaaaccaga cagagccgta ctatgacctg acaagcaatg cagtcctcac attcatctat tttgtggtct gcatcattgg gttgtgtggc aacacacttg tcatttatgt catcctccgc tatgccaaga tgaagaccat caccaacatt tacatcctca acctggccat cgcagatgag ctcttcatgc tgggtctgcc tttcttggct atgcaggtgg ctctggtcca ctggcccttt ggcaaggcca tttgccgggt ggtcatgact gtggatggca tcaatcagtt caccagcatc ttctgcctga cagtcatgag catcgaccga tacctggctg tggtccaccc catcaagtcg gccaagtgga ggagaccccg gacggccaag atgatcacca tggctgtgtg gggagtctct ctgctggtca tcttgcccat catgatatat gctgggctcc ggagcaacca gtgggggaga agcagctgca ccatcaactg gccaggtgaa tctggggctt ggtacacagg gttcatcatc tacactttca ttctggggtt cctggtaccc ctcaccatca tctgtctttg ctacctgttc attatcatca aggtgaagtc ctctggaatc cgagtgggct cctctaagag gaagaagtct gagaagaagg tcacccgaat ggtgtccatc gtggtggctg tcttcatctt ctgctggctt cccttctaca tattcaacgt ttcttccgtc tccatggcca tcagccccac cccagccctt aaaggcatgt ttgactttgt ggtggtcctc acctatgcta acagctgtgc caaccctatc ctatatgcct tcttgtctga caacttcaag aagagcttcc agaatgtcct ctgcttggtc aaggtgagcg gcacagatga tggggagcgg agtgacagta agcaggacaa atcccggctg aatgagacca cggagaccca gaggaccctc ctcaatggag acctccaaac cagtatctga. It is sometimes possible for the material contained within the vial of "SSTR2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.