Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

IRF4 cdna clone

IRF4 cDNA Clone

Gene Names
IRF4; MUM1; LSIRF; SHEP8; NF-EM5
Synonyms
IRF4; IRF4 cDNA Clone; IRF4 cdna clone
Ordering
For Research Use Only!
Sequence
atgaacctggagggcggcggccgaggcggagagttcggcatgagcgcggtgagctgcggcaacgggaagctccgccagtggctgatcgaccagatcgacagcggcaagtaccccgggctggtgtgggagaacgaggagaagagcatcttccgcatcccctggaagcacgcgggcaagcaggactacaaccgcgaggaggacgccgcgctcttcaaggcttgggcactgtttaaaggaaagttccgagaaggcatcgacaagccggaccctcccacctggaagacgcgcctgcggtgcgctttgaacaagagcaatgactttgaggaactggttgagcggagccagctggacatctcagacccgtacaaagtgtacaggattgttcctgagggagccaaaaaaggagccaagcagctcaccttggaggacccgcagatgtccatgagccacccctacaccatgacaacgccttacccttcgctcccagcccagcaggttcacaactacatgatgccacccctcgaccgaagctggagggactacgtcccggatcagccacacccggaaatcccgtaccaatgtcccatgacgtttggaccccgcggccaccactggcaaggcccagcttgtgaaaatggttgccaggtgacaggaaccttttatgcttgtgccccacctgagtcccaggctcccggagtccccacagagccaagcataaggtctgccgaagccttggcgttctcagactgccggctgcacatctgcctgtactaccgggaaatcctcgtgaaggagctgaccacgtccagccccgagggctgccggatctcccatggacatacgtatgacgccagcaacctggaccaggtcctgttcccctacccagaggacaatggccagaggaaaaacattgagaagctgctgagccacctggagaggggcgtggtcctctggatggcccccgacgggctctatgcgaaaagactgtgccagagcaggatctactgggacgggcccctggcgctgtgcaacgaccggcccaacaaactggagagagaccagacctgcaagctctttgacacacagcagttcttgtcagagctgcaagcgtttgctcaccacggccgctccctgccaagattccaggtgactctatgctttggagaggagtttccagaccctcagaggcaaagaaagctcatcacagctcacgtagaacctctgctagccagacaactatattattttgctcaacaaaacagtggacatttcctgaggggctacgatttaccagaacacatcagcaatccagaagattaccacagatctatccgccattcctctattcaagaatga
Sequence Length
1356
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
51,644 Da
NCBI Official Full Name
Homo sapiens interferon regulatory factor 4, mRNA
NCBI Official Synonym Full Names
interferon regulatory factor 4
NCBI Official Symbol
IRF4
NCBI Official Synonym Symbols
MUM1; LSIRF; SHEP8; NF-EM5
UniProt Protein Name
Interferon regulatory factor 4
UniProt Gene Name
IRF4
UniProt Synonym Gene Names
MUM1; IRF-4; LSIRF
UniProt Entry Name
IRF4_HUMAN

NCBI Description

The protein encoded by this gene belongs to the IRF (interferon regulatory factor) family of transcription factors, characterized by an unique tryptophan pentad repeat DNA-binding domain. The IRFs are important in the regulation of interferons in response to infection by virus, and in the regulation of interferon-inducible genes. This family member is lymphocyte specific and negatively regulates Toll-like-receptor (TLR) signaling that is central to the activation of innate and adaptive immune systems. A chromosomal translocation involving this gene and the IgH locus, t(6;14)(p25;q32), may be a cause of multiple myeloma. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Aug 2010]

Uniprot Description

IRF4: Transcriptional activator. Binds to the interferon- stimulated response element (ISRE) of the MHC class I promoter. Binds the immunoglobulin lambda light chain enhancer, together with PU.1. Probably plays a role in ISRE-targeted signal transduction mechanisms specific to lymphoid cells. Interacts with SPIB and DEF6. Not induced by interferons. Lymphoid cells. Belongs to the IRF family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Transcription factor; Oncoprotein; DNA-binding

Chromosomal Location of Human Ortholog: 6p25-p23

Cellular Component: cytoplasm; cytosol; membrane; nucleoplasm; nucleus

Molecular Function: protein binding; sequence-specific DNA binding; transcription factor activity

Biological Process: defense response to protozoan; positive regulation of interleukin-10 biosynthetic process; positive regulation of interleukin-13 biosynthetic process; positive regulation of interleukin-2 biosynthetic process; positive regulation of interleukin-4 biosynthetic process; positive regulation of transcription from RNA polymerase II promoter; positive regulation of transcription, DNA-dependent

Disease: Skin/hair/eye Pigmentation, Variation In, 8

Research Articles on IRF4

Similar Products

Product Notes

The IRF4 irf4 (Catalog #AAA1278261) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaacctgg agggcggcgg ccgaggcgga gagttcggca tgagcgcggt gagctgcggc aacgggaagc tccgccagtg gctgatcgac cagatcgaca gcggcaagta ccccgggctg gtgtgggaga acgaggagaa gagcatcttc cgcatcccct ggaagcacgc gggcaagcag gactacaacc gcgaggagga cgccgcgctc ttcaaggctt gggcactgtt taaaggaaag ttccgagaag gcatcgacaa gccggaccct cccacctgga agacgcgcct gcggtgcgct ttgaacaaga gcaatgactt tgaggaactg gttgagcgga gccagctgga catctcagac ccgtacaaag tgtacaggat tgttcctgag ggagccaaaa aaggagccaa gcagctcacc ttggaggacc cgcagatgtc catgagccac ccctacacca tgacaacgcc ttacccttcg ctcccagccc agcaggttca caactacatg atgccacccc tcgaccgaag ctggagggac tacgtcccgg atcagccaca cccggaaatc ccgtaccaat gtcccatgac gtttggaccc cgcggccacc actggcaagg cccagcttgt gaaaatggtt gccaggtgac aggaaccttt tatgcttgtg ccccacctga gtcccaggct cccggagtcc ccacagagcc aagcataagg tctgccgaag ccttggcgtt ctcagactgc cggctgcaca tctgcctgta ctaccgggaa atcctcgtga aggagctgac cacgtccagc cccgagggct gccggatctc ccatggacat acgtatgacg ccagcaacct ggaccaggtc ctgttcccct acccagagga caatggccag aggaaaaaca ttgagaagct gctgagccac ctggagaggg gcgtggtcct ctggatggcc cccgacgggc tctatgcgaa aagactgtgc cagagcagga tctactggga cgggcccctg gcgctgtgca acgaccggcc caacaaactg gagagagacc agacctgcaa gctctttgac acacagcagt tcttgtcaga gctgcaagcg tttgctcacc acggccgctc cctgccaaga ttccaggtga ctctatgctt tggagaggag tttccagacc ctcagaggca aagaaagctc atcacagctc acgtagaacc tctgctagcc agacaactat attattttgc tcaacaaaac agtggacatt tcctgagggg ctacgattta ccagaacaca tcagcaatcc agaagattac cacagatcta tccgccattc ctctattcaa gaatga. It is sometimes possible for the material contained within the vial of "IRF4, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.