ALKBH8 cdna clone

ALKBH8 cDNA Clone

Gene Names

ALKBH8; ABH8; TRM9; TRMT9

Synonyms

ALKBH8; ALKBH8 cDNA Clone; ALKBH8 cdna clone

Ordering
Cat. Num. AAA1278221 For Research Use Only!

Sequence

atggacagcaaccatcaaagtaattacaaactcagtaaaactgagaagaagttcttaaggaaacagattaaagccaagcatactttgctgagacatgaaggcattgagacagtatcctatgccactcagagcctggttgttgccaatggtggtttgggtaatggtgtgagtcggaaccagctgctcccggttttagagaaatgtggactggtggatgctctcttaatgccacctaacaagccgtactcatttgcaagatacagaactacagaagaatctaagagagcctatgttaccctcaatggaaaagaagtagtggatgatttaggacaaaagatcactctgtatttgaattttgtggaaaaagtgcagtggaaggagttgaggcctcaagccttaccaccaggactcatggtagtagaagaaataatttcttctgaggaggagaaaatgcttttggaaagtgttgattggacagaagatacagacaatcaaaactctcaaaaatccttaaaacacagaagagtaaagcattttggttatgagttccactatgagaacaacaatgtagataaagataagccattatctgggggtcttcctgacatttgtgaaagctttttggagaaatggttgaggaaaggttacattaaacataaacctgatcaaatgaccataaatcagtatgaacctgggcaagattgtcatggattttaa

Sequence Length

717

Vector

pENTR223.1 or pUC

Clone Sequence Report

Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #

15929508

NCBI GeneID

91801

Molecular Weight

75,558 Da

NCBI Official Full Name

Homo sapiens alkB, alkylation repair homolog 8 (E. coli), mRNA

NCBI Official Synonym Full Names

alkB homolog 8, tRNA methyltransferase

NCBI Official Symbol

ALKBH8

NCBI Official Synonym Symbols

ABH8; TRM9; TRMT9

NCBI Protein Information

alkylated DNA repair protein alkB homolog 8

UniProt Protein Name

Alkylated DNA repair protein alkB homolog 8

Protein Family

Alkylated DNA repair protein

UniProt Gene Name

ALKBH8

UniProt Synonym Gene Names

ABH8

UniProt Entry Name

ALKB8_HUMAN

Uniprot Description

ALKBH8: Catalyzes the methylation of 5-carboxymethyl uridine to 5-methylcarboxymethyl uridine at the wobble position of the anticodon loop in tRNA. Catalyzes the last step in the formation of 5-methylcarboxymethyl uridine at the wobble position of the anticodon loop in target tRNA. Has a preference for tRNA(Arg) and tRNA(Glu), and does not bind tRNA(Lys). Required for normal survival after DNA damage. May inhibit apoptosis and promote cell survival and angiogenesis. Belongs to the alkB family. 4 isoforms of the human protein are produced by alternative splicing.

Protein type: Methyltransferase; RNA processing; EC 2.1.1.229

Chromosomal Location of Human Ortholog: 11q22.3

Cellular Component: cytosol; microtubule cytoskeleton; nucleoplasm; nucleus

Molecular Function: ferrous iron binding; iron ion binding; oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors; protein binding; tRNA (uracil) methyltransferase activity; tRNA binding; zinc ion binding

Biological Process: response to DNA damage stimulus; tRNA methylation; tRNA wobble uridine modification

Research Articles on ALKBH8

1. Many eukaryotic tRNAs contain the wobble modification 5-methoxycarbonylmethyl-uridine (mcm5U). It is demonstrated that (R)- and (S)-5-methoxycarbonylhydroxymethyluridine (mchm5U), hydroxylated forms of mcm(5)U, are present in mammalian tRNA-Arg(UCG), and tRNA-Gly(UCC), respectively. It is shown that the hydroxylation reaction leading to the formation of (S)-mchm5U is catalyzed by the oxygenase (AlkB) domain of ALKBH8.

Similar Products

Product Notes

The ALKBH8 alkbh8 (Catalog #AAA1278221) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggacagca accatcaaag taattacaaa ctcagtaaaa ctgagaagaa gttcttaagg aaacagatta aagccaagca tactttgctg agacatgaag gcattgagac agtatcctat gccactcaga gcctggttgt tgccaatggt ggtttgggta atggtgtgag tcggaaccag ctgctcccgg ttttagagaa atgtggactg gtggatgctc tcttaatgcc acctaacaag ccgtactcat ttgcaagata cagaactaca gaagaatcta agagagccta tgttaccctc aatggaaaag aagtagtgga tgatttagga caaaagatca ctctgtattt gaattttgtg gaaaaagtgc agtggaagga gttgaggcct caagccttac caccaggact catggtagta gaagaaataa tttcttctga ggaggagaaa atgcttttgg aaagtgttga ttggacagaa gatacagaca atcaaaactc tcaaaaatcc ttaaaacaca gaagagtaaa gcattttggt tatgagttcc actatgagaa caacaatgta gataaagata agccattatc tgggggtctt cctgacattt gtgaaagctt tttggagaaa tggttgagga aaggttacat taaacataaa cctgatcaaa tgaccataaa tcagtatgaa cctgggcaag attgtcatgg attttaa. It is sometimes possible for the material contained within the vial of "ALKBH8, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Loading...

ALKBH8 cdna clone