CTBS cdna clone
CTBS cDNA Clone
Gene Names
CTBS; CTB
Synonyms
CTBS; CTBS cDNA Clone; CTBS cdna clone
Sequence
atgtcccggccgcagcttcgacgctggcgcctcgtctctagcccgccgagcggcgtcccgggtctagcgctgctggcgctgctggcgctgctggcgctgcggctcgcggccgggaccgactgcccatgcccggagcctgagctctgccgcccgattcgccaccatccagatttcgaggtctttgtgtttgatgttggacagaaaacttggaaatcttatgattggtcacagattacaactgtggcaacatttggaaaatatgactcagaacttatgtgctacgctcattcaaaaggagccagagtagtacttaaaggagatgtatccttaaaggatatcattgatcctgctttcagagcatcctggatagctcaaaaacttaatttggccaaaacacaatatatggatggaattaatatagatatagagcaagaagttaattgtttatcacctgaatatgatgcattaactgctttagtcaaagaaactacagactctttccatcgtgaaattgagggatcacaggtaacctttgatgtagcttggtctccaaagaacatagacagaagatgctataattatactggaatcgcagatgcttgtgacttcctctttgtgatgtcttatgatgaacaaagtcagatctggtcagaatgtattgcagcagccaatgctccctataatcagacattaactggatataatgactacatcaagatgagcattaatcctaagaaacttgtaatgggtgttccttggtatggttatgattatacctgcctgaatctgtctgaggatcatgtttgtaccattgcaaaagtccctttccggggggctccttgtagtgacgctgcaggacgtcaggtgccctacaaaacgatcatgaagcaaataaatagttctatttctggaaacctatgggataaagatcagcgggctccttattataactataaagatcctgctggccactttcatcaagtatggtatgataaccctcagagtatttctttaaaggcaacatatatacaaaactatcgcttacggggcattggcatgtggaatgcaaactgtcttgactactctggagatgctgtagccaaacagcaaactgaagaaatgtgggaagtcttaaagccaaagctgttacagagatga
Sequence Length
1158
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
43,760 Da
NCBI Official Full Name
Homo sapiens chitobiase, di-N-acetyl-, mRNA
NCBI Official Synonym Full Names
chitobiase
NCBI Official Symbol
CTBS
NCBI Official Synonym Symbols
CTB
NCBI Protein Information
di-N-acetylchitobiase
UniProt Protein Name
Di-N-acetylchitobiase
Protein Family
UniProt Gene Name
CTBS
UniProt Synonym Gene Names
CTB
UniProt Entry Name
DIAC_HUMAN
NCBI Description
Chitobiase is a lysosomal glycosidase involved in degradation of asparagine-linked oligosaccharides on glycoproteins (Aronson and Kuranda, 1989 [PubMed 2531691]).[supplied by OMIM, Nov 2010]
Uniprot Description
CTBS: Involved in the degradation of asparagine-linked glycoproteins. Hydrolyze of N-acetyl-beta-D-glucosamine (1-4)N- acetylglucosamine chitobiose core from the reducing end of the bond, it requires prior cleavage by glycosylasparaginase. Belongs to the glycosyl hydrolase 18 family.
Protein type: EC 3.2.1.-; Hydrolase
Chromosomal Location of Human Ortholog: 1p22
Cellular Component: extracellular space
Molecular Function: chitin binding; chitinase activity
Biological Process: chitin catabolic process
Research Articles on CTBS
Similar Products
Product Notes
The CTBS ctbs (Catalog #AAA1278166) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtcccggc cgcagcttcg acgctggcgc ctcgtctcta gcccgccgag cggcgtcccg ggtctagcgc tgctggcgct gctggcgctg ctggcgctgc ggctcgcggc cgggaccgac tgcccatgcc cggagcctga gctctgccgc ccgattcgcc accatccaga tttcgaggtc tttgtgtttg atgttggaca gaaaacttgg aaatcttatg attggtcaca gattacaact gtggcaacat ttggaaaata tgactcagaa cttatgtgct acgctcattc aaaaggagcc agagtagtac ttaaaggaga tgtatcctta aaggatatca ttgatcctgc tttcagagca tcctggatag ctcaaaaact taatttggcc aaaacacaat atatggatgg aattaatata gatatagagc aagaagttaa ttgtttatca cctgaatatg atgcattaac tgctttagtc aaagaaacta cagactcttt ccatcgtgaa attgagggat cacaggtaac ctttgatgta gcttggtctc caaagaacat agacagaaga tgctataatt atactggaat cgcagatgct tgtgacttcc tctttgtgat gtcttatgat gaacaaagtc agatctggtc agaatgtatt gcagcagcca atgctcccta taatcagaca ttaactggat ataatgacta catcaagatg agcattaatc ctaagaaact tgtaatgggt gttccttggt atggttatga ttatacctgc ctgaatctgt ctgaggatca tgtttgtacc attgcaaaag tccctttccg gggggctcct tgtagtgacg ctgcaggacg tcaggtgccc tacaaaacga tcatgaagca aataaatagt tctatttctg gaaacctatg ggataaagat cagcgggctc cttattataa ctataaagat cctgctggcc actttcatca agtatggtat gataaccctc agagtatttc tttaaaggca acatatatac aaaactatcg cttacggggc attggcatgt ggaatgcaaa ctgtcttgac tactctggag atgctgtagc caaacagcaa actgaagaaa tgtgggaagt cttaaagcca aagctgttac agagatga. It is sometimes possible for the material contained within the vial of "CTBS, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
