Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CATSPER1 cdna clone

CATSPER1 cDNA Clone

Gene Names
CATSPER1; SPGF7; CATSPER
Synonyms
CATSPER1; CATSPER1 cDNA Clone; CATSPER1 cdna clone
Ordering
For Research Use Only!
Sequence
atggatcaaaactcagtgcctgaaaaggctcagaatgaggcagacacaaataatgcagataggttctttcgctctcactcatcacccccacaccacaggccaggccacagcagagctctccaccattacgagttgcaccatcacggcgtgccccaccaacgtggtgaatctcaccaccctccggagttccaagacttccacgaccaagccttgtcctcccatgtccaccaatctcaccaccacagcgaggcacggaatcacgtcagagcccatggccccacaggctttggtctggctccctctcaaggcgccgtcccctcccaccgttcctacggtgaggactaccatgatgagctccaacgtgatggcaggaggcatcatgatgggtcccaatacagtgggttccatcagcagagtgactcccattaccatagggggtctcaccatggcagaccccaatatctcggtgagaatttatcccactattcctctggcgtgccccaccacggtgaggcttcccaccatggtgggtcctacctcccccatggacccaatccctacagtgagtccttccaccacagcgaggcttcccaccttagcgggctccaacacgatgagtcccagcatcaccaagtcccccaccgtggctggccccaccatcaccaagtccaccaccatggcaggtcccgtcatcatgaagcccaccagcatggaaagtctcctcatcacggagagaccatttcccctcattcctctgtggggtcctaccagcgtgggatatctgactatcacagcgagtaccaccaaggtgatcaccaccccagtgagtaccaccatggcgaccatccccaccacacacagcaccactaccaccagacccaccggcaccgagactaccatcagcaccaagaccaccacggcgcgtatcattccagttacctccatggcgactacgtccagagcacttcccaactctctatcccacacacatcccggagcctgattcacgatgcccccggccctgctgcttctcgtacaggagtcttcccctatcacgtagcacacccacggggctcggctcacagcatgactcggtcctccagcacaatccgctcacgtgtcacccagatgtccaaaaaagtccatacccaggatatctccaccaaacattcagaagactggggcaaagaagaagggcaatttcagaaacgcaaaaccggccggctccagcggacccgcaagaagggacactctaccaatctcttccagtggctgtgggaaaagctaaccttcctcattcagggcttccgggaaatgatccggaacctgacccaatccttggcctttgaaactttcatcttcttcgttgtctgcctcaacaccgtcatgctggtggcccagaccttcgctgaagtcgagatccggggcgagtggtacttcatggccttggactccatattcttctgcatctacgtggtggaagccctgctcaagatcatcgccctgggcctctcgtacttctttgacttctggaacaatttggacttcttcattatggccatggccgtgctggacttcttgctgatgcagacccactccttcgccatctaccaccaaagcctcttccggatcctcaaggtcttcaagagcctgcgggccctgagggcaatccgggtcctgcggaggctcagcttcctgaccagcgtccaggaagtgacagggaccctgggccagtccttgccgtccatcgcagccatcctcatcctcatgtttacctgcctcttcctcttctccgcggtcctccgggcactgttccgcaaatctgaccccaagcgcttccagaacatcttcaccaccatcttcaccctcttcaccttgctcacgctggatgactggtccctcatctacatggacagccgtgcccagggcgcctggtacatcattcccatcctcataatttacatcatcatccagtacttcatcttcctcaacctggtgattactgtcctggtggatagcttccagacggcgctgttcaaaggccttgagaaagcgaagcaggagagggccgcccggatccaagagaagctgctggaagactcactgacggagctcagagctgcagagcccaaagaggtggcgagtgaaggcaccatgctgaagcggctcatcgagaaaaagtttgggaccatgactgagaagcagcaggagctcctgttccattacctgcagctggtggcaagcgtggagcaggagcagcagaagttccgctcccaggcagccgtcatcgatgagattgtggacaccacatttgaggctggagaagaggacttcaggaattga
Sequence Length
2343
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
90,091 Da
NCBI Official Full Name
Homo sapiens cation channel, sperm associated 1, mRNA
NCBI Official Synonym Full Names
cation channel sperm associated 1
NCBI Official Symbol
CATSPER1
NCBI Official Synonym Symbols
SPGF7; CATSPER
NCBI Protein Information
cation channel sperm-associated protein 1
UniProt Protein Name
Cation channel sperm-associated protein 1
UniProt Gene Name
CATSPER1
UniProt Synonym Gene Names
CatSper1; hCatSper
UniProt Entry Name
CTSR1_HUMAN

NCBI Description

Calcium ions play a primary role in the regulation of sperm motility. This gene belongs to a family of putative cation channels that are specific to spermatozoa and localize to the flagellum. The protein family features a single repeat with six membrane-spanning segments and a predicted calcium-selective pore region. [provided by RefSeq, Jul 2008]

Uniprot Description

CATSPER1: Voltage-gated calcium channel that plays a central role in calcium-dependent physiological responses essential for successful fertilization, such as sperm hyperactivation, acrosome reaction and chemotaxis towards the oocyte. Activated by extracellular progesterone and prostaglandins following the sequence: progesterone > PGF1-alpha = PGE1 > PGA1 > PGE2 >> PGD2. The primary effect of progesterone activation is to shift voltage dependence towards more physiological, negative membrane potentials; it is not mediated by metabotropic receptors and second messengers. Sperm capacitation enhances the effect of progesterone by providing additional negative shift. Also activated by the elevation of intracellular pH. Defects in CATSPER1 are the cause of spermatogenic failure type 7 (SPGF7). An infertility disorder characterized by non-motile sperm or sperm motility below the normal threshold, low sperm count, increased abnormally structured spermatozoa, and reduced semen volume. Belongs to the cation channel sperm-associated (TC 1.A.1.19) family.

Protein type: Membrane protein, multi-pass; Membrane protein, integral

Chromosomal Location of Human Ortholog: 11q12.1

Cellular Component: plasma membrane

Molecular Function: protein binding; voltage-gated calcium channel activity

Biological Process: response to progesterone stimulus; sperm motility; sperm-egg recognition

Disease: Spermatogenic Failure 7

Research Articles on CATSPER1

Similar Products

Product Notes

The CATSPER1 catsper1 (Catalog #AAA1278150) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggatcaaa actcagtgcc tgaaaaggct cagaatgagg cagacacaaa taatgcagat aggttctttc gctctcactc atcaccccca caccacaggc caggccacag cagagctctc caccattacg agttgcacca tcacggcgtg ccccaccaac gtggtgaatc tcaccaccct ccggagttcc aagacttcca cgaccaagcc ttgtcctccc atgtccacca atctcaccac cacagcgagg cacggaatca cgtcagagcc catggcccca caggctttgg tctggctccc tctcaaggcg ccgtcccctc ccaccgttcc tacggtgagg actaccatga tgagctccaa cgtgatggca ggaggcatca tgatgggtcc caatacagtg ggttccatca gcagagtgac tcccattacc atagggggtc tcaccatggc agaccccaat atctcggtga gaatttatcc cactattcct ctggcgtgcc ccaccacggt gaggcttccc accatggtgg gtcctacctc ccccatggac ccaatcccta cagtgagtcc ttccaccaca gcgaggcttc ccaccttagc gggctccaac acgatgagtc ccagcatcac caagtccccc accgtggctg gccccaccat caccaagtcc accaccatgg caggtcccgt catcatgaag cccaccagca tggaaagtct cctcatcacg gagagaccat ttcccctcat tcctctgtgg ggtcctacca gcgtgggata tctgactatc acagcgagta ccaccaaggt gatcaccacc ccagtgagta ccaccatggc gaccatcccc accacacaca gcaccactac caccagaccc accggcaccg agactaccat cagcaccaag accaccacgg cgcgtatcat tccagttacc tccatggcga ctacgtccag agcacttccc aactctctat cccacacaca tcccggagcc tgattcacga tgcccccggc cctgctgctt ctcgtacagg agtcttcccc tatcacgtag cacacccacg gggctcggct cacagcatga ctcggtcctc cagcacaatc cgctcacgtg tcacccagat gtccaaaaaa gtccataccc aggatatctc caccaaacat tcagaagact ggggcaaaga agaagggcaa tttcagaaac gcaaaaccgg ccggctccag cggacccgca agaagggaca ctctaccaat ctcttccagt ggctgtggga aaagctaacc ttcctcattc agggcttccg ggaaatgatc cggaacctga cccaatcctt ggcctttgaa actttcatct tcttcgttgt ctgcctcaac accgtcatgc tggtggccca gaccttcgct gaagtcgaga tccggggcga gtggtacttc atggccttgg actccatatt cttctgcatc tacgtggtgg aagccctgct caagatcatc gccctgggcc tctcgtactt ctttgacttc tggaacaatt tggacttctt cattatggcc atggccgtgc tggacttctt gctgatgcag acccactcct tcgccatcta ccaccaaagc ctcttccgga tcctcaaggt cttcaagagc ctgcgggccc tgagggcaat ccgggtcctg cggaggctca gcttcctgac cagcgtccag gaagtgacag ggaccctggg ccagtccttg ccgtccatcg cagccatcct catcctcatg tttacctgcc tcttcctctt ctccgcggtc ctccgggcac tgttccgcaa atctgacccc aagcgcttcc agaacatctt caccaccatc ttcaccctct tcaccttgct cacgctggat gactggtccc tcatctacat ggacagccgt gcccagggcg cctggtacat cattcccatc ctcataattt acatcatcat ccagtacttc atcttcctca acctggtgat tactgtcctg gtggatagct tccagacggc gctgttcaaa ggccttgaga aagcgaagca ggagagggcc gcccggatcc aagagaagct gctggaagac tcactgacgg agctcagagc tgcagagccc aaagaggtgg cgagtgaagg caccatgctg aagcggctca tcgagaaaaa gtttgggacc atgactgaga agcagcagga gctcctgttc cattacctgc agctggtggc aagcgtggag caggagcagc agaagttccg ctcccaggca gccgtcatcg atgagattgt ggacaccaca tttgaggctg gagaagagga cttcaggaat tga. It is sometimes possible for the material contained within the vial of "CATSPER1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.