Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ABCE1 cdna clone

ABCE1 cDNA Clone

Gene Names
ABCE1; RLI; OABP; RLI1; ABC38; RNS4I; RNASEL1; RNASELI
Synonyms
ABCE1; ABCE1 cDNA Clone; ABCE1 cdna clone
Ordering
For Research Use Only!
Sequence
atggcagacaagttaacgagaattgctattgtcaaccatgacaaatgtaaacctaagaaatgtcgacaggaatgcaaaaagagttgtcctgtagttcgaatgggaaaattatgcatagaggttacaccccagagcaaaatagcatggatttccgaaactctttgtattggttgtggtatctgtattaagaaatgcccctttggcgccttatcaattgtcaatctaccaagcaacttggaaaaagaaaccacacatcgatattgtgccaatgccttcaaacttcacaggttgcctatccctcgtccaggtgaagttttgggattagttggaactaatggtattggaaagtcaactgctttaaaaattttagcaggaaaacaaaagccaaaccttggaaagtacgatgatcctcctgactggcaggagattttgacttatttccgtggatctgaattacaaaattactttacaaagattctagaagatgacctaaaagccatcatcaaacctcaatatgtagaccagattcctaaggctgcaaaggggacagtgggatctattttggaccgaaaagatgaaacaaagacacaggcaattgtatgtcagcagcttgatttaacccacctaaaagaacgaaatgttgaagatctttcaggaggagagttgcagagatttgcttgtgctgtcgtttgcatacagaaagctgatattttcatgtttgatgagccttctagttacctagatgtcaagcagcgtttaaaggctgctattactatacgatctctaataaatccagatagatatatcattgtggtggaacatgatctaagtgtattagactatctctccgacttcatctgctgtttatatggtgtaccaagcgcctatggagttgtcactatgccttttagtgtaagagaaggcataaacatttttttggatggctatgttccaacagaaaacttgagattcagagatgcatcacttgtttttaaagtggctgagacagcaaatgaagaagaagttaaaaagatgtgtatgtataaatatccaggaatgaagaaaaaaatgggagaatttgagctagcaattgtagctggagagtttacagattctgaaattatggtgatgctgggggaaaatggaacgggtaaaacgacatttatcagaatgcttgctggaagacttaaacctgatgaaggaggagaagtaccagttctaaatgtcagttataagccacagaaaattagtcccaaatcaactggaagtgttcgccagttactacatgaaaagataagagatgcttatactcacccacaatttgtgaccgatgtaatgaagcctctgcaaattgaaaacatcattgatcaagaggtgcagacattatctggtggtgaactacagcgagtagctttagccctttgcttgggcaaacctgctgatgtctatttaattgatgaaccatctgcatatttggattctgagcaaagactgatggcagctcgagttgtcaaacgtttcatactccatgcaaaaaagacagcctttgttgtggaacatgacttcatcatggccacctatctagcggatcgcgtcatcgtttttgatggtgttccatctaagaacacagttgcaaacagtcctcaaacccttttggctggcatgaataaatttttgtctcagcttgaaattacattcagaagagatccaaacaactataggccacgaataaacaaacttaattcaattaaggatgtagaacaaaagaagagtggaaactactttttcttggatgattag
Sequence Length
1800
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
67,314 Da
NCBI Official Full Name
Homo sapiens ATP-binding cassette, sub-family E (OABP), member 1, mRNA
NCBI Official Synonym Full Names
ATP binding cassette subfamily E member 1
NCBI Official Symbol
ABCE1
NCBI Official Synonym Symbols
RLI; OABP; RLI1; ABC38; RNS4I; RNASEL1; RNASELI
NCBI Protein Information
ATP-binding cassette sub-family E member 1
UniProt Protein Name
ATP-binding cassette sub-family E member 1
Protein Family
UniProt Gene Name
ABCE1
UniProt Synonym Gene Names
RLI; RNASEL1; RNASELI; RNS4I; RNS4I
UniProt Entry Name
ABCE1_HUMAN

NCBI Description

The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the OABP subfamily. Alternatively referred to as the RNase L inhibitor, this protein functions to block the activity of ribonuclease L. Activation of ribonuclease L leads to inhibition of protein synthesis in the 2-5A/RNase L system, the central pathway for viral interferon action. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]

Uniprot Description

ABCE1: Antagonizes the binding of 2-5A (5'-phosphorylated 2',5'-linked oligoadenylates) by RNase L through direct interaction with RNase L and therefore inhibits its endoribonuclease activity. May play a central role in the regulation of mRNA turnover. Antagonizes the anti-viral effect of the interferon-regulated 2-5A/RNase L pathway. May act as a chaperone for post-translational events during HIV-1 capsid assembly. Belongs to the ABC transporter superfamily. ABCE family.

Chromosomal Location of Human Ortholog: 4q31

Cellular Component: cytoplasm; eukaryotic translation initiation factor 3 complex; membrane; mitochondrial matrix; mitochondrion

Molecular Function: ATP binding; iron ion binding; protein binding; ribosomal small subunit binding

Biological Process: ribosome export from nucleus; translational initiation; translational termination; transmembrane transport

Research Articles on ABCE1

Similar Products

Product Notes

The ABCE1 abce1 (Catalog #AAA1278091) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcagaca agttaacgag aattgctatt gtcaaccatg acaaatgtaa acctaagaaa tgtcgacagg aatgcaaaaa gagttgtcct gtagttcgaa tgggaaaatt atgcatagag gttacacccc agagcaaaat agcatggatt tccgaaactc tttgtattgg ttgtggtatc tgtattaaga aatgcccctt tggcgcctta tcaattgtca atctaccaag caacttggaa aaagaaacca cacatcgata ttgtgccaat gccttcaaac ttcacaggtt gcctatccct cgtccaggtg aagttttggg attagttgga actaatggta ttggaaagtc aactgcttta aaaattttag caggaaaaca aaagccaaac cttggaaagt acgatgatcc tcctgactgg caggagattt tgacttattt ccgtggatct gaattacaaa attactttac aaagattcta gaagatgacc taaaagccat catcaaacct caatatgtag accagattcc taaggctgca aaggggacag tgggatctat tttggaccga aaagatgaaa caaagacaca ggcaattgta tgtcagcagc ttgatttaac ccacctaaaa gaacgaaatg ttgaagatct ttcaggagga gagttgcaga gatttgcttg tgctgtcgtt tgcatacaga aagctgatat tttcatgttt gatgagcctt ctagttacct agatgtcaag cagcgtttaa aggctgctat tactatacga tctctaataa atccagatag atatatcatt gtggtggaac atgatctaag tgtattagac tatctctccg acttcatctg ctgtttatat ggtgtaccaa gcgcctatgg agttgtcact atgcctttta gtgtaagaga aggcataaac atttttttgg atggctatgt tccaacagaa aacttgagat tcagagatgc atcacttgtt tttaaagtgg ctgagacagc aaatgaagaa gaagttaaaa agatgtgtat gtataaatat ccaggaatga agaaaaaaat gggagaattt gagctagcaa ttgtagctgg agagtttaca gattctgaaa ttatggtgat gctgggggaa aatggaacgg gtaaaacgac atttatcaga atgcttgctg gaagacttaa acctgatgaa ggaggagaag taccagttct aaatgtcagt tataagccac agaaaattag tcccaaatca actggaagtg ttcgccagtt actacatgaa aagataagag atgcttatac tcacccacaa tttgtgaccg atgtaatgaa gcctctgcaa attgaaaaca tcattgatca agaggtgcag acattatctg gtggtgaact acagcgagta gctttagccc tttgcttggg caaacctgct gatgtctatt taattgatga accatctgca tatttggatt ctgagcaaag actgatggca gctcgagttg tcaaacgttt catactccat gcaaaaaaga cagcctttgt tgtggaacat gacttcatca tggccaccta tctagcggat cgcgtcatcg tttttgatgg tgttccatct aagaacacag ttgcaaacag tcctcaaacc cttttggctg gcatgaataa atttttgtct cagcttgaaa ttacattcag aagagatcca aacaactata ggccacgaat aaacaaactt aattcaatta aggatgtaga acaaaagaag agtggaaact actttttctt ggatgattag. It is sometimes possible for the material contained within the vial of "ABCE1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.