Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PDCD6 cdna clone

PDCD6 cDNA Clone

Gene Names
PDCD6; ALG2; ALG-2; PEF1B
Synonyms
PDCD6; PDCD6 cDNA Clone; PDCD6 cdna clone
Ordering
For Research Use Only!
Sequence
atggccgcctactcttaccgccccggccctgggcctgctgcaggcgcggcgctgccggaccagagcttcctgtggaacgttttccagagggtcgataaagacaggagtggagtgatatcagacaccgagcttcagcaagctctctccaacggcacgtggactccctttaatccagtgactgtcaggtcgatcatatgtaagtatcggcagacggaccaacctgggctgctttgtatccgacccgcttgggtacccgcttgtgtttcctttgtctgtgggtccgtatcactttgctcccttctggaattccacttagatgagcgtcggccctttcatccctctccctccgtctctgtaccttttcacatctctccgtgtatgtttgctctattcttgattctgtttatttttaatgtacggtgtaacctgtcctttcagtttctaattctaaagatgacatatatttaa
Sequence Length
468
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
7,349 Da
NCBI Official Full Name
Homo sapiens programmed cell death 6, mRNA
NCBI Official Synonym Full Names
programmed cell death 6
NCBI Official Symbol
PDCD6
NCBI Official Synonym Symbols
ALG2; ALG-2; PEF1B
NCBI Protein Information
programmed cell death protein 6
UniProt Protein Name
Programmed cell death protein 6
UniProt Gene Name
PDCD6
UniProt Synonym Gene Names
ALG2
UniProt Entry Name
PDCD6_HUMAN

NCBI Description

This gene encodes a calcium-binding protein belonging to the penta-EF-hand protein family. Calcium binding is important for homodimerization and for conformational changes required for binding to other protein partners. This gene product participates in T cell receptor-, Fas-, and glucocorticoid-induced programmed cell death. In mice deficient for this gene product, however, apoptosis was not blocked suggesting this gene product is functionally redundant. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and a pseudogene of this gene is also located on the short arm of chromosome 5. [provided by RefSeq, May 2012]

Uniprot Description

PDCD6: Calcium-binding protein required for T-cell receptor-, Fas-, and glucocorticoid-induced cell death. May mediate Ca(2+)- regulated signals along the death pathway. Calcium-dependent adapter necessary for the association between PDCD6IP and TSG101. Interaction with DAPK1 can accelerate apoptotic cell death by increasing caspase-3 activity.

Chromosomal Location of Human Ortholog: 5p15.33

Cellular Component: cytoplasm; cytoplasmic vesicle; endoplasmic reticulum; nucleus

Molecular Function: calcium ion binding; calcium-dependent cysteine-type endopeptidase activity; calcium-dependent protein binding; identical protein binding; molecular adaptor activity; protein anchor; protein binding; protein dimerization activity

Biological Process: intracellular protein transport; negative regulation of protein kinase B signaling cascade; negative regulation of TOR signaling pathway; negative regulation of vascular endothelial growth factor receptor signaling pathway; positive regulation of angiogenesis; positive regulation of caspase activity; positive regulation of endothelial cell proliferation; response to calcium ion

Research Articles on PDCD6

Similar Products

Product Notes

The PDCD6 pdcd6 (Catalog #AAA1278086) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggccgcct actcttaccg ccccggccct gggcctgctg caggcgcggc gctgccggac cagagcttcc tgtggaacgt tttccagagg gtcgataaag acaggagtgg agtgatatca gacaccgagc ttcagcaagc tctctccaac ggcacgtgga ctccctttaa tccagtgact gtcaggtcga tcatatgtaa gtatcggcag acggaccaac ctgggctgct ttgtatccga cccgcttggg tacccgcttg tgtttccttt gtctgtgggt ccgtatcact ttgctccctt ctggaattcc acttagatga gcgtcggccc tttcatccct ctccctccgt ctctgtacct tttcacatct ctccgtgtat gtttgctcta ttcttgattc tgtttatttt taatgtacgg tgtaacctgt cctttcagtt tctaattcta aagatgacat atatttaa. It is sometimes possible for the material contained within the vial of "PDCD6, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.