Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

RAP2C cdna clone

RAP2C cDNA Clone

Synonyms
RAP2C; RAP2C cDNA Clone; RAP2C cdna clone
Ordering
For Research Use Only!
Sequence
atgagggaatacaaggtagtggtgttagggagtggaggggttggcaaatctgcccttactgtgcagtttgtcactgggactttcattgagaaatatgaccccaccattgaagatttctaccgcaaagagatcgaagtggactcttccccctccgtgctggaaattctggacaccgcaggaactgagcagtttgcctccatgagagatctctacatcaaaaacggccaaggtttcatcctggtttatagcctggttaatcaacagtcttttcaggatatcaagccaatgagagatcaaattgtcagagtgaagagatatgaaaaagtcccactaatcctagtaggaaataaagtggatctggaaccagaaagagaggttatgtcttcagaaggcagagctctggttcaagaatggggctgtcctttcatggagacatcggcaaaaagtaaatcaatggtggatgaactttttgctgagatcgtcaggcaaatgaactattcatccctgccggagaagcaagatcagtgttgtacaacttgtgtcgtccagtaa
Sequence Length
552
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
20,745 Da
NCBI Official Full Name
Homo sapiens RAP2C, member of RAS oncogene family, mRNA
NCBI Official Synonym Full Names
RAP2C, member of RAS oncogene family
NCBI Official Symbol
RAP2C
NCBI Protein Information
ras-related protein Rap-2c
UniProt Protein Name
Ras-related protein Rap-2c
Protein Family
UniProt Gene Name
RAP2C
UniProt Entry Name
RAP2C_HUMAN

NCBI Description

The protein encoded by this gene is a member of the Ras-related protein subfamily of the Ras GTPase superfamily. Members of this family are small GTPases that act as molecular switches to regulate cellular proliferation, differentiation, and apoptosis. This protein has been reported to activate in vitro transcriptional activity of the serum response element. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2012]

Uniprot Description

RAP2C: Small GTP-binding protein which cycles between a GDP- bound inactive and a GTP-bound active form. May play a role in cytoskeletal rearrangements and regulate cell spreading through activation of the effector TNIK. May play a role in SRE-mediated gene transcription. Belongs to the small GTPase superfamily. Ras family.

Protein type: G protein, monomeric, Ras; G protein; G protein, monomeric

Chromosomal Location of Human Ortholog: Xq25

Cellular Component: cytoplasm; plasma membrane; recycling endosome membrane; tight junction

Molecular Function: GDP binding; GTP binding; transcription coactivator activity

Biological Process: microvillus biogenesis; negative regulation of cell migration; positive regulation of protein amino acid autophosphorylation; Rap protein signal transduction

Research Articles on RAP2C

Similar Products

Product Notes

The RAP2C rap2c (Catalog #AAA1278030) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgagggaat acaaggtagt ggtgttaggg agtggagggg ttggcaaatc tgcccttact gtgcagtttg tcactgggac tttcattgag aaatatgacc ccaccattga agatttctac cgcaaagaga tcgaagtgga ctcttccccc tccgtgctgg aaattctgga caccgcagga actgagcagt ttgcctccat gagagatctc tacatcaaaa acggccaagg tttcatcctg gtttatagcc tggttaatca acagtctttt caggatatca agccaatgag agatcaaatt gtcagagtga agagatatga aaaagtccca ctaatcctag taggaaataa agtggatctg gaaccagaaa gagaggttat gtcttcagaa ggcagagctc tggttcaaga atggggctgt cctttcatgg agacatcggc aaaaagtaaa tcaatggtgg atgaactttt tgctgagatc gtcaggcaaa tgaactattc atccctgccg gagaagcaag atcagtgttg tacaacttgt gtcgtccagt aa. It is sometimes possible for the material contained within the vial of "RAP2C, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.