Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

IL1RAPL1 cdna clone

IL1RAPL1 cDNA Clone

Gene Names
IL1RAPL1; IL1R8; MRX10; MRX21; MRX34; OPHN4; IL1RAPL; TIGIRR-2
Synonyms
IL1RAPL1; IL1RAPL1 cDNA Clone; IL1RAPL1 cdna clone
Ordering
For Research Use Only!
Sequence
atgaaagctccgattccacacttgattctcttatacgctacttttactcagagtttgaaggttgtgaccaaaagaggctccgccgatggatgcactgactggtctatcgatatcaagaaatatcaagttttggtgggagagcctgttcgaatcaaatgtgcactcttttatggttatatcagaacaaattactcccttgcccaaagtgctggactcagtttgatgtggtacaaaagttctggtcctggagactttgaagagccaatagcctttgacggaagtagaatgagcaaagaagaagactccatttggttccggccaacattgctacaggacagtggtctctacgcctgtgtcatcagaaactccacttactgtatgaaagtatccatctcactgacagtgggtgaaaatgacactggactctgctataattccaagatgaagtattttgaaaaagctgaacttagcaaaagcaaggaaatttcatgccgtgacatagaggattttctactgccaaccagagaacctgaaatcctttggtacaaggaatgcaggacaaaaacatggaggccaagtattgtattcaaaagagatactctgcttataagagaagtcagagaagatgacattggaaattatacctgtgaattaaaatatggaggctttgttgtgagaagaactactgaattaactgttacagcccctctgactgataagccacccaagcttttgtatcctatggaaagtaaactgacaattcaggagacccagctgggtgactctgctaatctaacctgcagagctttctttgggtacagcggagatgtcagtcctttaatttactggatgaaaggagaaaaatttattgaagatctggatgaaaatcgagtttgggaaagtgacattagaattcttaaggagcatcttggggaacaggaagtttccatctcattaattgtggactctgtggaagaaggtgacttgggaaattactcctgttatgttgaaaatggaaatggacgtcgacacgccagcgttctccttcataaacgagagctaatgtacacagtggaacttgctggaggccttggtgctatactcttgctgcttgtatgtttggtgaccatctacaagtgttacaagatagaaatcatgctcttctacaggaatcattttggagctgaagagctcgatggagacaataaagattatgatgcatacttatcatacaccaaagtggatcctgaccagtggaatcaagagactggggaagaagaacgttttgcccttgaaatcctacctgatatgctcgaaaagcattatggatataagttgtttataccagatagagatttaatcccaactggaacatacattgaagatgtggcaagatgtgtagatcaaagcaagcggctgattattgtcatgaccccaaattacgtagttagaaggggctggagcatctttgagctggaaaccagacttcgaaatatgcttgtgactggagaaattaaagtgattctaattgaatgcagtgaactgagaggaattatgaactaccaggaggtggaggccctgaagcacaccatcaagctcctgacggtcattaaatggcatggaccaaaatgcaacaagttgaactccaagttctggaaacgtttacagtatgaaatgccttttaagaggatagaacccattacacatgagcaggctttagatgtcagtgagcaagggccttttggggagctgcagactgtctcggccatttccatggccgcggccacctccacagctctagccactgcccatccagatctccgttctacctttcacaacacgtaccattcacaaatgcgtcagaaacactactaccgaagctatgagtacgacgtacctcctaccggcaccctgcctcttacctccataggcaatcagcatacctactgtaacatccctatgacactcatcaacgggcagcggccacagacaaaatcgagcagggagcagaatccagatgaggcccacacaaacagtgccatcctgccgctgttgccaagggagaccagtatatccagtgtgatatggtga
Sequence Length
2091
Vector
pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
79,969 Da
NCBI Official Full Name
Homo sapiens interleukin 1 receptor accessory protein-like 1, mRNA
NCBI Official Synonym Full Names
interleukin 1 receptor accessory protein like 1
NCBI Official Symbol
IL1RAPL1
NCBI Official Synonym Symbols
IL1R8; MRX10; MRX21; MRX34; OPHN4; IL1RAPL; TIGIRR-2
NCBI Protein Information
interleukin-1 receptor accessory protein-like 1
UniProt Protein Name
Interleukin-1 receptor accessory protein-like 1
UniProt Gene Name
IL1RAPL1
UniProt Synonym Gene Names
OPHN4; IL-1-RAPL-1; IL-1RAPL-1; IL1RAPL-1; TIGIRR-2
UniProt Entry Name
IRPL1_HUMAN

NCBI Description

The protein encoded by this gene is a member of the interleukin 1 receptor family and is similar to the interleukin 1 accessory proteins. It is most closely related to interleukin 1 receptor accessory protein-like 2 (IL1RAPL2). This gene and IL1RAPL2 are located at a region on chromosome X that is associated with X-linked non-syndromic mental retardation. Deletions and mutations in this gene were found in patients with mental retardation. This gene is expressed at a high level in post-natal brain structures involved in the hippocampal memory system, which suggests a specialized role in the physiological processes underlying memory and learning abilities. [provided by RefSeq, Jul 2008]

Uniprot Description

IL1RAPL1: May regulate secretion and presynaptic differentiation through inhibition of the activity of N-type voltage-gated calcium channel. May activate the MAP kinase JNK. Plays a role in presynaptic and postsynaptic differentiation and dendritic spine formation in neurons. Defects in IL1RAPL1 are the cause of mental retardation X-linked type 21 (MRX21). Mental retardation is a mental disorder characterized by significantly sub-average general intellectual functioning associated with impairments in adaptative behavior and manifested during the developmental period. Non- syndromic mental retardation patients do not manifest other clinical signs. Belongs to the interleukin-1 receptor family. 1 isoforms of the human protein are produced by alternative splicing.

Protein type: Receptor, misc.; Membrane protein, integral

Chromosomal Location of Human Ortholog: Xp22.1-p21.3

Cellular Component: cell surface; dendrite; plasma membrane

Molecular Function: interleukin-1 binding; protein binding; receptor binding; voltage-gated calcium channel activity

Biological Process: heterophilic cell adhesion; negative regulation of exocytosis; neuron differentiation; positive regulation of dendrite morphogenesis

Disease: Mental Retardation, X-linked 21

Research Articles on IL1RAPL1

Similar Products

Product Notes

The IL1RAPL1 il1rapl1 (Catalog #AAA1277947) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaaagctc cgattccaca cttgattctc ttatacgcta cttttactca gagtttgaag gttgtgacca aaagaggctc cgccgatgga tgcactgact ggtctatcga tatcaagaaa tatcaagttt tggtgggaga gcctgttcga atcaaatgtg cactctttta tggttatatc agaacaaatt actcccttgc ccaaagtgct ggactcagtt tgatgtggta caaaagttct ggtcctggag actttgaaga gccaatagcc tttgacggaa gtagaatgag caaagaagaa gactccattt ggttccggcc aacattgcta caggacagtg gtctctacgc ctgtgtcatc agaaactcca cttactgtat gaaagtatcc atctcactga cagtgggtga aaatgacact ggactctgct ataattccaa gatgaagtat tttgaaaaag ctgaacttag caaaagcaag gaaatttcat gccgtgacat agaggatttt ctactgccaa ccagagaacc tgaaatcctt tggtacaagg aatgcaggac aaaaacatgg aggccaagta ttgtattcaa aagagatact ctgcttataa gagaagtcag agaagatgac attggaaatt atacctgtga attaaaatat ggaggctttg ttgtgagaag aactactgaa ttaactgtta cagcccctct gactgataag ccacccaagc ttttgtatcc tatggaaagt aaactgacaa ttcaggagac ccagctgggt gactctgcta atctaacctg cagagctttc tttgggtaca gcggagatgt cagtccttta atttactgga tgaaaggaga aaaatttatt gaagatctgg atgaaaatcg agtttgggaa agtgacatta gaattcttaa ggagcatctt ggggaacagg aagtttccat ctcattaatt gtggactctg tggaagaagg tgacttggga aattactcct gttatgttga aaatggaaat ggacgtcgac acgccagcgt tctccttcat aaacgagagc taatgtacac agtggaactt gctggaggcc ttggtgctat actcttgctg cttgtatgtt tggtgaccat ctacaagtgt tacaagatag aaatcatgct cttctacagg aatcattttg gagctgaaga gctcgatgga gacaataaag attatgatgc atacttatca tacaccaaag tggatcctga ccagtggaat caagagactg gggaagaaga acgttttgcc cttgaaatcc tacctgatat gctcgaaaag cattatggat ataagttgtt tataccagat agagatttaa tcccaactgg aacatacatt gaagatgtgg caagatgtgt agatcaaagc aagcggctga ttattgtcat gaccccaaat tacgtagtta gaaggggctg gagcatcttt gagctggaaa ccagacttcg aaatatgctt gtgactggag aaattaaagt gattctaatt gaatgcagtg aactgagagg aattatgaac taccaggagg tggaggccct gaagcacacc atcaagctcc tgacggtcat taaatggcat ggaccaaaat gcaacaagtt gaactccaag ttctggaaac gtttacagta tgaaatgcct tttaagagga tagaacccat tacacatgag caggctttag atgtcagtga gcaagggcct tttggggagc tgcagactgt ctcggccatt tccatggccg cggccacctc cacagctcta gccactgccc atccagatct ccgttctacc tttcacaaca cgtaccattc acaaatgcgt cagaaacact actaccgaag ctatgagtac gacgtacctc ctaccggcac cctgcctctt acctccatag gcaatcagca tacctactgt aacatcccta tgacactcat caacgggcag cggccacaga caaaatcgag cagggagcag aatccagatg aggcccacac aaacagtgcc atcctgccgc tgttgccaag ggagaccagt atatccagtg tgatatggtg a. It is sometimes possible for the material contained within the vial of "IL1RAPL1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.