Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

DOLK cdna clone

DOLK cDNA Clone

Gene Names
DOLK; DK; DK1; CDG1M; SEC59; TMEM15
Synonyms
DOLK; DOLK cDNA Clone; DOLK cdna clone
Ordering
For Research Use Only!
Sequence
atgacccgagagtgcccatctccggccccggggcctggggctccgctgagtggatcggtgctggcagaggcggcagtagtgtttgcagtggtgctgagcatccacgcaaccgtatgggaccgatactcgtggtgcgccgtggccctcgcagtgcaggccttctacgtccaatacaagtgggaccggctgctacagcagggaagcgccgtcttccagttccgaatgtccgcaaacagtggcctattgcccgcctccatggtcatgcctttgcttggactagtcatgaaggagcggtgccagactgctgggaacccgttctttgagcgttttggcattgtggtggcagccactggcatggcagtggccctcttctcatcagtgttggcgctcggcatcactcgcccagtgccaaccaacacttgtgtcatcttgggcttggctggaggtgttatcatttatatcatgaagcactcgttgagcgtgggggaggtgatcgaagtcctggaagtccttctgatcttcgtttatctcaacatgatcctgctgtacctgctgccccgctgcttcacccctggtgaggcactgctggtattgggtggcattagctttgtcctcaaccagctcatcaagcgctctctgacactggtggaaagtcagggggacccagtggacttcttcctgctggtggtggtagtagggatggtactcatgggcattttcttcagcactctgtttgtcttcatggactcaggcacctgggcctcctccatcttcttccacctcatgacctgtgtgctgagccttggtgtggtcctaccctggctgcaccggctcatccgcaggaatcccctgctctggcttcttcagtttctcttccagacagacacccgcatctacctcctagcctattggtctctgctggccaccttggcctgcctggtggtgctgtaccagaatgccaagcggtcatcttccgagtccaagaagcaccaggcccccaccatcgcccgaaagtatttccacctcattgtggtagccacctacatcccaggtatcatctttgaccggccactgctctatgtagccgccactgtatgcctggcggtcttcatcttcctggagtatgtgcgctacttccgcatcaagcctttgggtcacactctacggagcttcctgtccctttttctggatgaacgagacagtggaccactcattctgacacacatctacctgctcctgggcatgtctcttcccatctggctgatccccagaccctgcacacagaagggtagcctgggaggagccagggccctcgtcccctatgccggtgtcctggctgtgggtgtgggtgatactgtggcctccatcttcggtagcaccatgggggagatccgctggcctggaaccaaaaagacttttgaggggaccatgacatctatatttgcgcagatcatttctgtagctctgatcttaatctttgacagtggagtggacctaaactacagttatgcttggattttggggtccatcagcactgtgtccctcctggaagcatacactacacagatagacaatctccttctgcctctctacctcctgatattgctgatggcctag
Sequence Length
1617
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
59,268 Da
NCBI Official Full Name
Homo sapiens dolichol kinase, mRNA
NCBI Official Synonym Full Names
dolichol kinase
NCBI Official Symbol
DOLK
NCBI Official Synonym Symbols
DK; DK1; CDG1M; SEC59; TMEM15
NCBI Protein Information
dolichol kinase
UniProt Protein Name
Dolichol kinase
UniProt Gene Name
DOLK
UniProt Synonym Gene Names
KIAA1094; TMEM15
UniProt Entry Name
DOLK_HUMAN

NCBI Description

The protein encoded by this gene catalyzes the CTP-mediated phosphorylation of dolichol, and is involved in the synthesis of Dol-P-Man, which is an essential glycosyl carrier lipid for C- and O-mannosylation, N- and O-linked glycosylation of proteins, and for the biosynthesis of glycosyl phosphatidylinositol anchors in endoplasmic reticulum. Mutations in this gene are associated with dolichol kinase deficiency.[provided by RefSeq, Apr 2010]

Uniprot Description

DOLK: Involved in the synthesis of the sugar donor Dol-P-Man which is required in the synthesis of N-linked and O-linked oligosaccharides and for that of GPI anchors. Defects in DOLK are the cause of congenital disorder of glycosylation type 1M (CDG1M); also known as dolichol kinase deficiency. CDGs are a family of severe inherited diseases caused by a defect in glycoprotein biosynthesis. They are characterized by under-glycosylated serum glycoproteins. These multisystem disorders present with a wide variety of clinical features, such as disorders of the nervous system development, psychomotor retardation, dysmorphic features, hypotonia, coagulation disorders, and immunodeficiency. The broad spectrum of features reflects the critical role of N-glycoproteins during embryonic development, differentiation, and maintenance of cell functions. CDG1M is a very severe disorder with death occurring in early infancy. Belongs to the polyprenol kinase family.

Protein type: Membrane protein, integral; EC 2.7.1.108; Kinase, other; Membrane protein, multi-pass; Endoplasmic reticulum

Chromosomal Location of Human Ortholog: 9q34.11

Cellular Component: endoplasmic reticulum membrane; integral to endoplasmic reticulum membrane

Molecular Function: dolichol kinase activity; protein binding

Biological Process: dolichyl diphosphate biosynthetic process; dolichyl monophosphate biosynthetic process

Disease: Congenital Disorder Of Glycosylation, Type Im

Research Articles on DOLK

Similar Products

Product Notes

The DOLK dolk (Catalog #AAA1277916) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgacccgag agtgcccatc tccggccccg gggcctgggg ctccgctgag tggatcggtg ctggcagagg cggcagtagt gtttgcagtg gtgctgagca tccacgcaac cgtatgggac cgatactcgt ggtgcgccgt ggccctcgca gtgcaggcct tctacgtcca atacaagtgg gaccggctgc tacagcaggg aagcgccgtc ttccagttcc gaatgtccgc aaacagtggc ctattgcccg cctccatggt catgcctttg cttggactag tcatgaagga gcggtgccag actgctggga acccgttctt tgagcgtttt ggcattgtgg tggcagccac tggcatggca gtggccctct tctcatcagt gttggcgctc ggcatcactc gcccagtgcc aaccaacact tgtgtcatct tgggcttggc tggaggtgtt atcatttata tcatgaagca ctcgttgagc gtgggggagg tgatcgaagt cctggaagtc cttctgatct tcgtttatct caacatgatc ctgctgtacc tgctgccccg ctgcttcacc cctggtgagg cactgctggt attgggtggc attagctttg tcctcaacca gctcatcaag cgctctctga cactggtgga aagtcagggg gacccagtgg acttcttcct gctggtggtg gtagtaggga tggtactcat gggcattttc ttcagcactc tgtttgtctt catggactca ggcacctggg cctcctccat cttcttccac ctcatgacct gtgtgctgag ccttggtgtg gtcctaccct ggctgcaccg gctcatccgc aggaatcccc tgctctggct tcttcagttt ctcttccaga cagacacccg catctacctc ctagcctatt ggtctctgct ggccaccttg gcctgcctgg tggtgctgta ccagaatgcc aagcggtcat cttccgagtc caagaagcac caggccccca ccatcgcccg aaagtatttc cacctcattg tggtagccac ctacatccca ggtatcatct ttgaccggcc actgctctat gtagccgcca ctgtatgcct ggcggtcttc atcttcctgg agtatgtgcg ctacttccgc atcaagcctt tgggtcacac tctacggagc ttcctgtccc tttttctgga tgaacgagac agtggaccac tcattctgac acacatctac ctgctcctgg gcatgtctct tcccatctgg ctgatcccca gaccctgcac acagaagggt agcctgggag gagccagggc cctcgtcccc tatgccggtg tcctggctgt gggtgtgggt gatactgtgg cctccatctt cggtagcacc atgggggaga tccgctggcc tggaaccaaa aagacttttg aggggaccat gacatctata tttgcgcaga tcatttctgt agctctgatc ttaatctttg acagtggagt ggacctaaac tacagttatg cttggatttt ggggtccatc agcactgtgt ccctcctgga agcatacact acacagatag acaatctcct tctgcctctc tacctcctga tattgctgat ggcctag. It is sometimes possible for the material contained within the vial of "DOLK, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.