Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

HSD17B12 cdna clone

HSD17B12 cDNA Clone

Gene Names
HSD17B12; KAR; SDR12C1
Synonyms
HSD17B12; HSD17B12 cDNA Clone; HSD17B12 cdna clone
Ordering
For Research Use Only!
Sequence
atggagagcgctctccccgccgccggcttcctgtactgggtcggcgcgggcaccgtggcctacctagccctgcgtatttcgtactcgctcttcacggccctccgggtctggggagtggggaatgaggcgggggtcggcccggggctcggagaatgggcagttgtcacaggtagtactgatggaattggaaaatcatatgcagaagagttagcaaagcatggaatgaaggttgtccttatcagcagatcaaaggataaacttgaccaggtttccagtgaaataagcaattatacttga
Sequence Length
297
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
10,342 Da
NCBI Official Full Name
Homo sapiens hydroxysteroid (17-beta) dehydrogenase 12, mRNA
NCBI Official Synonym Full Names
hydroxysteroid 17-beta dehydrogenase 12
NCBI Official Symbol
HSD17B12
NCBI Official Synonym Symbols
KAR; SDR12C1
NCBI Protein Information
very-long-chain 3-oxoacyl-CoA reductase
UniProt Protein Name
Very-long-chain 3-oxoacyl-CoA reductase
UniProt Gene Name
HSD17B12
UniProt Synonym Gene Names
KAR
UniProt Entry Name
DHB12_HUMAN

NCBI Description

This gene encodes a very important 17beta-hydroxysteroid dehydrogenase (17beta-HSD) that converts estrone into estradiol in ovarian tissue. This enzyme is also involved in fatty acid elongation. [provided by RefSeq, Oct 2011]

Uniprot Description

HSD17B12: Catalyzes the transformation of estrone (E1) into estradiol (E2), suggesting a central role in estrogen formation. Its strong expression in ovary and mammary gland suggest that it may constitute the major enzyme responsible for the conversion of E1 to E2 in women. Also has 3-ketoacyl-CoA reductase activity, reducing both long chain 3-ketoacyl-CoAs and long chain fatty acyl-CoAs, suggesting a role in long fatty acid elongation. Belongs to the short-chain dehydrogenases/reductases (SDR) family. 17-beta-HSD 3 subfamily.

Protein type: Membrane protein, integral; Lipid Metabolism - unsaturated fatty acid biosynthesis; EC 1.1.1.62; Oxidoreductase; Lipid Metabolism - androgen and estrogen; Membrane protein, multi-pass

Chromosomal Location of Human Ortholog: 11p11.2

Cellular Component: endoplasmic reticulum membrane

Molecular Function: long-chain-3-hydroxyacyl-CoA dehydrogenase activity; protein binding

Research Articles on HSD17B12

Similar Products

Product Notes

The HSD17B12 hsd17b12 (Catalog #AAA1277903) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggagagcg ctctccccgc cgccggcttc ctgtactggg tcggcgcggg caccgtggcc tacctagccc tgcgtatttc gtactcgctc ttcacggccc tccgggtctg gggagtgggg aatgaggcgg gggtcggccc ggggctcgga gaatgggcag ttgtcacagg tagtactgat ggaattggaa aatcatatgc agaagagtta gcaaagcatg gaatgaaggt tgtccttatc agcagatcaa aggataaact tgaccaggtt tccagtgaaa taagcaatta tacttga. It is sometimes possible for the material contained within the vial of "HSD17B12, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.