Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

HTR2A cdna clone

HTR2A cDNA Clone

Gene Names
HTR2A; HTR2; 5-HT2A
Synonyms
HTR2A; HTR2A cDNA Clone; HTR2A cdna clone
Ordering
For Research Use Only!
Sequence
atggatattctttgtgaagaaaatacttctttgagctcaactacgaactccctaatgcaattaaatgatgacaccaggctctacagtaatgactttaactccggagaagctaacacttctgatgcatttaactggacagtcgactctgaaaatcgaaccaacctttcctgtgaagggtgcctctcaccgtcgtgtctctccttacttcatctccaggaaaaaaactggtctgctttactgacagccgtagtgattattctaactattgctggaaacatactcgtcatcatggcagtgtccctagagaaaaagctgcagaatgccaccaactatttcctgatgtcacttgccatagctgatatgctgctgggtttccttgtcatgcccgtgtccatgttaaccatcctgtatgggtaccggtggcctctgccgagcaagctttgtgcagtctggatttacctggacgtgctcttctccacggcctccatcatgcacctctgcgccatctcgctggaccgctacgtcgccatccagaatcccatccaccacagccgcttcaactccagaactaaggcatttctgaaaatcattgctgtttggaccatatcagtaggtatatccatgccaataccagtctttgggctacaggacgattcgaaggtctttaaggaggggagttgcttactcgccgatgataactttgtcctgatcggctcttttgtgtcatttttcattcccttaaccatcatggtgatcacctactttctaactatcaagtcactccagaaagaagctactttgtgtgtaagtgatcttggcacacgggccaaattagcttctttcagcttcctccctcagagttctttgtcttcagaaaagctcttccagcggtcgatccatagggagccagggtcctacacaggcaggaggactatgcagtccatcagcaatgagcaaaaggcatgcaaggtgctgggcatcgtcttcttcctgtttgtggtgatgtggtgccctttcttcatcacaaacatcatggccgtcatctgcaaagagtcctgcaatgaggatgtcattggggccctgctcaatgtgtttgtttggatcggttatctctcttcagcagtcaacccactagtctacacactgttcaacaagacctataggtcagccttttcacggtatattcagtgtcagtacaaggaaaacaaaaaaccattgcagttaattttagtgaacacaataccggctttggcctacaagtctagccaacttcaaatgggacaaaaaaagaattcaaagcaagatgccaagacaacagataatgactgctcaatggttgctctaggaaagcagcattctgaagaggcttctaaagacaatagcgacggagtgaatgaaaaggtgagctgtgtgtga
Sequence Length
1416
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
43,940 Da
NCBI Official Full Name
Homo sapiens 5-hydroxytryptamine (serotonin) receptor 2A, mRNA
NCBI Official Synonym Full Names
5-hydroxytryptamine receptor 2A
NCBI Official Symbol
HTR2A
NCBI Official Synonym Symbols
HTR2; 5-HT2A
NCBI Protein Information
5-hydroxytryptamine receptor 2A
UniProt Protein Name
5-hydroxytryptamine receptor 2A
UniProt Gene Name
HTR2A
UniProt Synonym Gene Names
HTR2; 5-HT-2; 5-HT-2A
UniProt Entry Name
5HT2A_HUMAN

NCBI Description

This gene encodes one of the receptors for serotonin, a neurotransmitter with many roles. Mutations in this gene are associated with susceptibility to schizophrenia and obsessive-compulsive disorder, and are also associated with response to the antidepressant citalopram in patients with major depressive disorder (MDD). MDD patients who also have a mutation in intron 2 of this gene show a significantly reduced response to citalopram as this antidepressant downregulates expression of this gene. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]

Uniprot Description

5-HT(2A): This is one of the several different receptors for 5- hydroxytryptamine (serotonin), a biogenic hormone that functions as a neurotransmitter, a hormone, and a mitogen. This receptor mediates its action by association with G proteins that activate a phosphatidylinositol-calcium second messenger system. This receptor is involved in tracheal smooth muscle contraction, bronchoconstriction, and control of aldosterone production. Belongs to the G-protein coupled receptor 1 family.

Protein type: Membrane protein, multi-pass; Membrane protein, integral; GPCR, family 1; Receptor, GPCR

Chromosomal Location of Human Ortholog: 13q14-q21

Cellular Component: plasma membrane

Molecular Function: drug binding; serotonin binding; serotonin receptor activity

Biological Process: cellular calcium ion homeostasis; phosphoinositide 3-kinase cascade; phospholipase C activation; positive regulation of phosphatidylinositol biosynthetic process; release of sequestered calcium ion into cytosol; response to drug; serotonin receptor signaling pathway; synaptic transmission

Disease: Alcohol Dependence; Anorexia Nervosa, Susceptibility To, 1; Major Depressive Disorder; Obsessive-compulsive Disorder; Schizophrenia

Research Articles on HTR2A

Similar Products

Product Notes

The HTR2A htr2a (Catalog #AAA1277861) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggatattc tttgtgaaga aaatacttct ttgagctcaa ctacgaactc cctaatgcaa ttaaatgatg acaccaggct ctacagtaat gactttaact ccggagaagc taacacttct gatgcattta actggacagt cgactctgaa aatcgaacca acctttcctg tgaagggtgc ctctcaccgt cgtgtctctc cttacttcat ctccaggaaa aaaactggtc tgctttactg acagccgtag tgattattct aactattgct ggaaacatac tcgtcatcat ggcagtgtcc ctagagaaaa agctgcagaa tgccaccaac tatttcctga tgtcacttgc catagctgat atgctgctgg gtttccttgt catgcccgtg tccatgttaa ccatcctgta tgggtaccgg tggcctctgc cgagcaagct ttgtgcagtc tggatttacc tggacgtgct cttctccacg gcctccatca tgcacctctg cgccatctcg ctggaccgct acgtcgccat ccagaatccc atccaccaca gccgcttcaa ctccagaact aaggcatttc tgaaaatcat tgctgtttgg accatatcag taggtatatc catgccaata ccagtctttg ggctacagga cgattcgaag gtctttaagg aggggagttg cttactcgcc gatgataact ttgtcctgat cggctctttt gtgtcatttt tcattccctt aaccatcatg gtgatcacct actttctaac tatcaagtca ctccagaaag aagctacttt gtgtgtaagt gatcttggca cacgggccaa attagcttct ttcagcttcc tccctcagag ttctttgtct tcagaaaagc tcttccagcg gtcgatccat agggagccag ggtcctacac aggcaggagg actatgcagt ccatcagcaa tgagcaaaag gcatgcaagg tgctgggcat cgtcttcttc ctgtttgtgg tgatgtggtg ccctttcttc atcacaaaca tcatggccgt catctgcaaa gagtcctgca atgaggatgt cattggggcc ctgctcaatg tgtttgtttg gatcggttat ctctcttcag cagtcaaccc actagtctac acactgttca acaagaccta taggtcagcc ttttcacggt atattcagtg tcagtacaag gaaaacaaaa aaccattgca gttaatttta gtgaacacaa taccggcttt ggcctacaag tctagccaac ttcaaatggg acaaaaaaag aattcaaagc aagatgccaa gacaacagat aatgactgct caatggttgc tctaggaaag cagcattctg aagaggcttc taaagacaat agcgacggag tgaatgaaaa ggtgagctgt gtgtga. It is sometimes possible for the material contained within the vial of "HTR2A, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.