Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PFKM cdna clone

PFKM cDNA Clone

Gene Names
PFKM; GSD7; PFK1; PFKA; PFKX; PFK-1; ATP-PFK; PPP1R122
Synonyms
PFKM; PFKM cDNA Clone; PFKM cdna clone
Ordering
For Research Use Only!
Sequence
atgacccatgaagagcaccatgcagccaaaaccctggggattggcaaagccattgctgtcttaacctctggtggagatgcccaaggtatgaatgctgctgtcagggctgtggttcgagttggtatcttcaccggtgcccgtgtcttctttgtccatgagggttatcaaggcctggtggatggtggagatcacatcaaggaagccacctgggagagcgtttcgatgatgcttcagctgggaggcacggtgattggaagtgcccggtgcaaggactttcgggaacgagaaggacgactccgagctgcctacaacctggtgaagcgtgggatcaccaatctctgtgtcattgggggtgatggcagcctcactggggctgacaccttccgttctgagtggagtgacttgttgagtgacctccagaaagcaggtaagatcacagatgaggaggctacgaagtccagctacctgaacattgtgggcctggttgggtcaattgacaatgacttctgtggcaccgatatgaccattggcactgactctgccctgcatcggatcatggaaattgtagatgccatcactaccactgcccagagccaccagaggacatttgtgttagaagtaatgggccgccactgtggatacctggcccttgtcacctctctgtcctgtggggccgactgggtttttattcctgaatgtccaccagatgacgactgggaggaacacctttgtcgccgactcagcgagacaaggacccgtggttctcgtctcaacatcatcattgtggctgagggtgcaattgacaagaatggaaaaccaatcacctcagaagacatcaagaatctggtggttaagcgtctgggatatgacacccgggttactgtcttggggcatgtgcagaggggtgggacgccatcagcctttgacagaattctgggcagcaggatgggtgtggaagcagtgatggcacttttggaggggaccccagataccccagcctgtgtagtgagcctctctggtaaccaggctgtgcgcctgcccctcatggaatgtgtccaggtgaccaaagatgtgaccaaggccatggatgagaagaaatttgacgaagccctgaagctgagaggccggagcttcatgaacaactgggaggtgtacaagcttctagctcatgtcagacccccggtatctaagagtggttcgcacacagtggctgtgatgaacgtgggggctccggctgcaggcatgaatgctgctgttcgctccactgtgaggattggccttatccagggcaaccgagtgctcgttgtccatgatggtttcgagggcctggccaaggggcagatagaggaagctggctggagctatgttgggggctggactggccaaggtggctctaaacttgggactaaaaggactctacccaagaagagctttgaacagatcagtgccaatataactaagtttaacattcagggccttgtcatcattgggggctttgaggcttacacagggggcctggaactgatggagggcaggaagcagtttgatgagctctgcatcccatttgtggtcattcctgctacagtctccaacaatgtccctggctcagacttcagcgttggggctgacacagcactcaatactatctgcacaacctgtgaccgcatcaagcagtcagcagctggcaccaagcgtcgggtgtttatcattgagactatgggtggctactgtggctacctggctaccatggctggactggcagctggggccgatgctgcctacatttttgaggagcccttcaccattcgagacctgcaggcaaatgttgaacatctggtgcaaaagatgaaaacaactgtgaaaaggggcttggtgttaaggaatgaaaagtgcaatgagaactataccactgacttcattttcaacctgtactctgaggaggggaagggcatcttcgacagcaggaagaatgtgcttggtcacatgcagcagggtgggagcccaaccccatttgataggaattttgccactaagatgggcgccaaggctatgaactggatgtctgggaaaatcaaagagagttaccgtaatgggcggatctttgccaatactccagattcgggctgtgttctggggatgcgtaagagggctctggtcttccaaccagtggctgagctgaaggaccagacagattttgagcatcgaatccccaaggaacagtggtggctgaaactgaggcccatcctcaaaatcctagccaagtacgagattgacttggacacttcagaccatgcccacctggagcacatcacccggaagcggtccggggaagcggccgtctaa
Sequence Length
2343
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
93,254 Da
NCBI Official Full Name
Homo sapiens phosphofructokinase, muscle, mRNA
NCBI Official Synonym Full Names
phosphofructokinase, muscle
NCBI Official Symbol
PFKM
NCBI Official Synonym Symbols
GSD7; PFK1; PFKA; PFKX; PFK-1; ATP-PFK; PPP1R122
NCBI Protein Information
ATP-dependent 6-phosphofructokinase, muscle type
UniProt Protein Name
ATP-dependent 6-phosphofructokinase, muscle type
UniProt Gene Name
PFKM
UniProt Synonym Gene Names
PFKX; ATP-PFK; PFK-M
UniProt Entry Name
PFKAM_HUMAN

NCBI Description

Three phosphofructokinase isozymes exist in humans: muscle, liver and platelet. These isozymes function as subunits of the mammalian tetramer phosphofructokinase, which catalyzes the phosphorylation of fructose-6-phosphate to fructose-1,6-bisphosphate. Tetramer composition varies depending on tissue type. This gene encodes the muscle-type isozyme. Mutations in this gene have been associated with glycogen storage disease type VII, also known as Tarui disease. Alternatively spliced transcript variants have been described.[provided by RefSeq, Nov 2009]

Uniprot Description

PFKM: phosphofructokinase, muscle type. An ubiquitous metabolic enzyme involved in the synthesis and degradation of fructose 2,6-bisphosphate. Key control step of glycolysis. An allosteric enzyme activated by ADP, AMP, or fructose bisphosphate and inhibited by ATP or citrate. Activity: ATP D-fructose 6-phosphate = ADP D-fructose 1,6-bisphosphate. The holoenzyme consists of 4 subunits. The liver and muscle enzymes are homo-tetramers of four liver or muscle isoforms, respectively. The red blood cell enzyme consists hetero-tetramers of the muscle and liver isoforms. A subunit composition with a higher proportion of platelet type subunits is found in platelets, brain and fibroblasts. Defects in PFKM are the cause of glycogen storage disease VII (GSD-VII) also known as Tarui disease. Two alternatively spliced isoforms have been described.

Protein type: Kinase, other; Carbohydrate Metabolism - galactose; Carbohydrate Metabolism - pentose phosphate pathway; Carbohydrate Metabolism - fructose and mannose; EC 2.7.1.11; Carbohydrate Metabolism - glycolysis and gluconeogenesis

Chromosomal Location of Human Ortholog: 12q13.3

Cellular Component: 6-phosphofructokinase complex; apical plasma membrane; cytosol

Molecular Function: 6-phosphofructokinase activity; ATP binding; identical protein binding; kinase binding; protein binding; protein C-terminus binding

Biological Process: fructose 6-phosphate metabolic process; glycolysis; muscle maintenance; protein oligomerization

Disease: Glycogen Storage Disease Vii

Research Articles on PFKM

Similar Products

Product Notes

The PFKM pfkm (Catalog #AAA1277851) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgacccatg aagagcacca tgcagccaaa accctgggga ttggcaaagc cattgctgtc ttaacctctg gtggagatgc ccaaggtatg aatgctgctg tcagggctgt ggttcgagtt ggtatcttca ccggtgcccg tgtcttcttt gtccatgagg gttatcaagg cctggtggat ggtggagatc acatcaagga agccacctgg gagagcgttt cgatgatgct tcagctggga ggcacggtga ttggaagtgc ccggtgcaag gactttcggg aacgagaagg acgactccga gctgcctaca acctggtgaa gcgtgggatc accaatctct gtgtcattgg gggtgatggc agcctcactg gggctgacac cttccgttct gagtggagtg acttgttgag tgacctccag aaagcaggta agatcacaga tgaggaggct acgaagtcca gctacctgaa cattgtgggc ctggttgggt caattgacaa tgacttctgt ggcaccgata tgaccattgg cactgactct gccctgcatc ggatcatgga aattgtagat gccatcacta ccactgccca gagccaccag aggacatttg tgttagaagt aatgggccgc cactgtggat acctggccct tgtcacctct ctgtcctgtg gggccgactg ggtttttatt cctgaatgtc caccagatga cgactgggag gaacaccttt gtcgccgact cagcgagaca aggacccgtg gttctcgtct caacatcatc attgtggctg agggtgcaat tgacaagaat ggaaaaccaa tcacctcaga agacatcaag aatctggtgg ttaagcgtct gggatatgac acccgggtta ctgtcttggg gcatgtgcag aggggtggga cgccatcagc ctttgacaga attctgggca gcaggatggg tgtggaagca gtgatggcac ttttggaggg gaccccagat accccagcct gtgtagtgag cctctctggt aaccaggctg tgcgcctgcc cctcatggaa tgtgtccagg tgaccaaaga tgtgaccaag gccatggatg agaagaaatt tgacgaagcc ctgaagctga gaggccggag cttcatgaac aactgggagg tgtacaagct tctagctcat gtcagacccc cggtatctaa gagtggttcg cacacagtgg ctgtgatgaa cgtgggggct ccggctgcag gcatgaatgc tgctgttcgc tccactgtga ggattggcct tatccagggc aaccgagtgc tcgttgtcca tgatggtttc gagggcctgg ccaaggggca gatagaggaa gctggctgga gctatgttgg gggctggact ggccaaggtg gctctaaact tgggactaaa aggactctac ccaagaagag ctttgaacag atcagtgcca atataactaa gtttaacatt cagggccttg tcatcattgg gggctttgag gcttacacag ggggcctgga actgatggag ggcaggaagc agtttgatga gctctgcatc ccatttgtgg tcattcctgc tacagtctcc aacaatgtcc ctggctcaga cttcagcgtt ggggctgaca cagcactcaa tactatctgc acaacctgtg accgcatcaa gcagtcagca gctggcacca agcgtcgggt gtttatcatt gagactatgg gtggctactg tggctacctg gctaccatgg ctggactggc agctggggcc gatgctgcct acatttttga ggagcccttc accattcgag acctgcaggc aaatgttgaa catctggtgc aaaagatgaa aacaactgtg aaaaggggct tggtgttaag gaatgaaaag tgcaatgaga actataccac tgacttcatt ttcaacctgt actctgagga ggggaagggc atcttcgaca gcaggaagaa tgtgcttggt cacatgcagc agggtgggag cccaacccca tttgatagga attttgccac taagatgggc gccaaggcta tgaactggat gtctgggaaa atcaaagaga gttaccgtaa tgggcggatc tttgccaata ctccagattc gggctgtgtt ctggggatgc gtaagagggc tctggtcttc caaccagtgg ctgagctgaa ggaccagaca gattttgagc atcgaatccc caaggaacag tggtggctga aactgaggcc catcctcaaa atcctagcca agtacgagat tgacttggac acttcagacc atgcccacct ggagcacatc acccggaagc ggtccgggga agcggccgtc taa. It is sometimes possible for the material contained within the vial of "PFKM, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.