ZCCHC11 cdna clone
ZCCHC11 cDNA Clone
Gene Names
ZCCHC11; TUT4; PAPD3
Synonyms
ZCCHC11; ZCCHC11 cDNA Clone; ZCCHC11 cdna clone
Sequence
atggaagagtctaaaaccttaaaaagtgaaaatcatgaaccaaagaagaatgttatttgtgaagaaagcaaagcagttcaagttataggtaatcaaacattgaaagctagaaatgataaatccgtaaaagaaattgagaacagctctccaaataggaatagtagtaaaaaaaataagcaaaatgatatttgtatagaaaaaacagaagttaaatcatgtaaagtaaatgctgccaaccttccaggtcctaaagatttggggttagtccttcgagatcaaagtcattgcaaagcaaaaaaatttcctaattcaccggtgaaagccgaaaaggcaaccatttcacaggcaaaatcagaaaaggcaaccagtttacaggcaatagcagaaaaatcaccaaagtcacctaattcagtgaaagcagaaaaagcatccagttatcagatgaagtcagaaaaagtaccaagttcaccagcagaagcagaaaagggacccagtttactgttgaaagacatgagacagaagacagaattacaacagattggaaaaaaaattccaagctcctttacttctgtggacaaagtgaatattgaagctgtagggggagaaaaatgtgctctgcaaaactcaccacgatctcagaagcaacagacatgtacagataatactggtgattctgatgatagtgcttcaggaattgaagacgtatcggacgatttaagtaaaatgaagaatgatgaatctaataaagaaaattcttcagagatggactacttagaaaatgccactgtgatagatgaatctgcattgacacctgagcagaggctggggttgaaacaagcagaagaacgcttagaaagagatcacatctttcgacttgaaaaagtatactatgttgttttagttatttggggggaaatgtgtgtttcataa
Sequence Length
930
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
81,141 Da
NCBI Official Full Name
Homo sapiens zinc finger, CCHC domain containing 11, mRNA
NCBI Official Synonym Full Names
zinc finger CCHC-type containing 11
NCBI Official Symbol
ZCCHC11
NCBI Official Synonym Symbols
TUT4; PAPD3
NCBI Protein Information
terminal uridylyltransferase 4
UniProt Protein Name
Terminal uridylyltransferase 4
Protein Family
UniProt Gene Name
ZCCHC11
UniProt Synonym Gene Names
KIAA0191; TUT4; TUTase 4
UniProt Entry Name
TUT4_HUMAN
NCBI Description
ZCCHC11 is an RNA uridyltransferase (EC 2.7.7.52) that uses UTP to add uridines to the 3-prime end of substrate RNA molecules (Jones et al., 2009 [PubMed 19701194]).[supplied by OMIM, Jan 2011]
Uniprot Description
ZCCHC11: a zinc finger protein that may participate in toll-receptor signaling by suppressing TRAF6-dependent activation of NF-kappaB. Two alternatively spliced isoforms have been reported.
Protein type: RNA processing; EC 2.7.7.52; Transferase; Cell development/differentiation
Chromosomal Location of Human Ortholog: 1p32.3
Cellular Component: cytoplasm; extracellular space; nucleolus
Molecular Function: protein binding; RNA uridylyltransferase activity
Biological Process: pre-microRNA processing; RNA 3'-end processing; stem cell maintenance
Research Articles on ZCCHC11
Similar Products
Product Notes
The ZCCHC11 zcchc11 (Catalog #AAA1277844) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggaagagt ctaaaacctt aaaaagtgaa aatcatgaac caaagaagaa tgttatttgt gaagaaagca aagcagttca agttataggt aatcaaacat tgaaagctag aaatgataaa tccgtaaaag aaattgagaa cagctctcca aataggaata gtagtaaaaa aaataagcaa aatgatattt gtatagaaaa aacagaagtt aaatcatgta aagtaaatgc tgccaacctt ccaggtccta aagatttggg gttagtcctt cgagatcaaa gtcattgcaa agcaaaaaaa tttcctaatt caccggtgaa agccgaaaag gcaaccattt cacaggcaaa atcagaaaag gcaaccagtt tacaggcaat agcagaaaaa tcaccaaagt cacctaattc agtgaaagca gaaaaagcat ccagttatca gatgaagtca gaaaaagtac caagttcacc agcagaagca gaaaagggac ccagtttact gttgaaagac atgagacaga agacagaatt acaacagatt ggaaaaaaaa ttccaagctc ctttacttct gtggacaaag tgaatattga agctgtaggg ggagaaaaat gtgctctgca aaactcacca cgatctcaga agcaacagac atgtacagat aatactggtg attctgatga tagtgcttca ggaattgaag acgtatcgga cgatttaagt aaaatgaaga atgatgaatc taataaagaa aattcttcag agatggacta cttagaaaat gccactgtga tagatgaatc tgcattgaca cctgagcaga ggctggggtt gaaacaagca gaagaacgct tagaaagaga tcacatcttt cgacttgaaa aagtatacta tgttgtttta gttatttggg gggaaatgtg tgtttcataa. It is sometimes possible for the material contained within the vial of "ZCCHC11, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
