IL22 cdna clone
IL22 cDNA Clone
Gene Names
IL22; TIFa; IL-21; IL-22; ILTIF; IL-TIF; IL-D110; zcyto18; TIFIL-23
Synonyms
IL22; IL22 cDNA Clone; IL22 cdna clone
Sequence
atggccgccctgcagaaatctgtgagctctttccttatggggaccctggccaccagctgcctccttctcttggccctcttggtacagggaggagcagctgcgcccatcagctcccactgcaggcttgacaagtccaacttccagcagccctatatcaccaaccgcaccttcatgctggctaaggaggctagcttggctgataacaacacagacgttcgtctcattggggagaaactgttccacggagtcagtatgagtgagcgctgctatctgatgaagcaggtgctgaacttcacccttgaagaagtgctgttccctcaatctgataggttccagccttatatgcaggaggtggtgcccttcctggccaggctcagcaacaggctaagcacatgtcatattgaaggtgatgacctgcatatccagaggaatgtgcaaaagctgaaggacacagtgaaaaagcttggagagagtggagagatcaaagcaattggagaactggatttgctgtttatgtctctgagaaatgcctgcatttga
Sequence Length
540
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
20,011 Da
NCBI Official Full Name
Homo sapiens interleukin 22, mRNA
NCBI Official Synonym Full Names
interleukin 22
NCBI Official Symbol
IL22
NCBI Official Synonym Symbols
TIFa; IL-21; IL-22; ILTIF; IL-TIF; IL-D110; zcyto18; TIFIL-23
NCBI Protein Information
interleukin-22
UniProt Protein Name
Interleukin-22
Protein Family
UniProt Gene Name
IL22
UniProt Synonym Gene Names
ILTIF; ZCYTO18; IL-22; IL-TIF
UniProt Entry Name
IL22_HUMAN
Uniprot Description
IL22: Cytokine that contributes to the inflammatory response in vivo. Belongs to the IL-10 family.
Protein type: Secreted, signal peptide; Secreted; Cytokine
Chromosomal Location of Human Ortholog: 12q15
Cellular Component: extracellular region; extracellular space
Molecular Function: cytokine activity; protein binding
Biological Process: cell-cell signaling; immune response; inflammatory response; positive regulation of JAK-STAT cascade
Research Articles on IL22
Similar Products
Product Notes
The IL22 il22 (Catalog #AAA1277841) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggccgccc tgcagaaatc tgtgagctct ttccttatgg ggaccctggc caccagctgc ctccttctct tggccctctt ggtacaggga ggagcagctg cgcccatcag ctcccactgc aggcttgaca agtccaactt ccagcagccc tatatcacca accgcacctt catgctggct aaggaggcta gcttggctga taacaacaca gacgttcgtc tcattgggga gaaactgttc cacggagtca gtatgagtga gcgctgctat ctgatgaagc aggtgctgaa cttcaccctt gaagaagtgc tgttccctca atctgatagg ttccagcctt atatgcagga ggtggtgccc ttcctggcca ggctcagcaa caggctaagc acatgtcata ttgaaggtga tgacctgcat atccagagga atgtgcaaaa gctgaaggac acagtgaaaa agcttggaga gagtggagag atcaaagcaa ttggagaact ggatttgctg tttatgtctc tgagaaatgc ctgcatttga. It is sometimes possible for the material contained within the vial of "IL22, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
