UBASH3B cdna clone
UBASH3B cDNA Clone
Gene Names
UBASH3B; p70; STS1; STS-1; TULA2; TULA-2
Synonyms
UBASH3B; UBASH3B cDNA Clone; UBASH3B cdna clone
Sequence
atggctcagtacggccaccccagtccgctcggcatggctgcgagagaggagctgtacagcaaagtcaccccccggaggaaccgccaacagcgccccggcaccatcaagcatggatcggcgctggacgtgctcctctccatggggttccccagagcccgcgcacaaaaagccttggcatccacgggaggaagaagtgttcaggcagcatgtgactggttattctcccatgtcggtgaccccttcctggatgaccccctgccccgggagtacgtcctctacctccgtcccaccggccccttagcacagaagctttccgacttttggcagcagtcgaagcagatctgcgggaagaacaaggcacacaacatcttcccccacatcacactctgccagttctttatgtgcgaggacagcaaggtggatgccctgggggaagccctgcagaccacggtcagtcgctggaaatgtaagttctcggccccgctgcccctggagctctatacgtcgtccaacttcatcggcctctttgtaaaggaagacagtgcggaggtcctcaagaagtttgctgctgactttgctgcagaggctgcatccaaaaccgaagtgcatgtggaacctcataagaagcagctacatgtgaccctggcttaccacttccaagccagccacctacccaccctagagaaactggcccagaacattgacgtcaagctagggtgtgactgggtggctaccatattttctcgggatatccgatttgctaaccatgagacattacaggtcatctacccctataccccacaaaatgacgatgagctggagctggtccccggggacttcatcttcatgtctccaatggagcagaccagcaccagcgagggttggatctatggcacgtccttaaccaccggctgctctggactcctgcctgagaattacattaccaaggctgatgaatgcagcacctggatatttcatggttcttattcaatcttaaatacatcgtcatccaactctctcacgtttggggatggagtattggagaggcggccttatgaggaccaggggctcggggagacgactcctcttactatcatctgccagcccatgcagccgctgagggtcaacagccagcccggcccccagaagcgatgcctttttgtgtgtcggcatggtgagaggatggatgttgtgtttgggaagtactggctgtcccagtgcttcgatgccaaaggccgctacatacgcaccaacctgaacatgcctcatagtttacctcagcggagtggtggtttccgagattacgagaaagatgctcccatcactgtgtttggatgcatgcaagcaagactagtgggtgaagccttattagagagcaataccattatcgatcatgtctattgctccccgtcccttcgctgcgttcagactgcacacaatatcttgaaaggtttacaacaagaaaatcacttgaagatccgtgtagagcccggcttatttgagtggacaaaatgggttgctgggagcacattacctgcatggatacctccatcagagttagctgcagccaacctgagtgttgatacaacctacagacctcacattccaatcagcaaattagttgtttcagaatcctatgatacttatatcagtagaagtttccaagtaacaaaagaaataataagtgaatgtaaaagtaaaggaaataacatcctgattgtggcccacgcatcttcccttgaagcgtgtacctgccaacttcagggcctgtcacctcagaactccaaggacttcgtacaaatggtccgaaagatcccatatctgggattttgttcctgtgaagaattaggagaaactggaatatggcagctgacagatccaccaatccttcctcttacccatggaccaactgggggcttcaactggagagagaccttgcttcaagaataa
Sequence Length
1950
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
72,696 Da
NCBI Official Full Name
Homo sapiens ubiquitin associated and SH3 domain containing, B, mRNA
NCBI Official Synonym Full Names
ubiquitin associated and SH3 domain containing B
NCBI Official Symbol
UBASH3B
NCBI Official Synonym Symbols
p70; STS1; STS-1; TULA2; TULA-2
NCBI Protein Information
ubiquitin-associated and SH3 domain-containing protein B
UniProt Protein Name
Ubiquitin-associated and SH3 domain-containing protein B
Protein Family
UniProt Gene Name
UBASH3B
UniProt Synonym Gene Names
KIAA1959; STS1; STS-1; TULA-2
UniProt Entry Name
UBS3B_HUMAN
NCBI Description
This gene encodes a protein that contains a ubiquitin associated domain at the N-terminus, an SH3 domain, and a C-terminal domain with similarities to the catalytic motif of phosphoglycerate mutase. The encoded protein was found to inhibit endocytosis of epidermal growth factor receptor (EGFR) and platelet-derived growth factor receptor. [provided by RefSeq, Jul 2008]
Uniprot Description
STS-1: Interferes with CBL-mediated down-regulation and degradation of receptor-type tyrosine kinases. Promotes accumulation of activated target receptors, such as T-cell receptors and EGFR, on the cell surface. Exhibits tyrosine phosphatase activity toward several substrates including EGFR, FAK, SYK, and ZAP70. Down-regulates proteins that are dually modified by both protein tyrosine phosphorylation and ubiquitination.
Protein type: Protein phosphatase, tyrosine (non-receptor); EC 3.1.3.48
Chromosomal Location of Human Ortholog: 11q24.1
Molecular Function: protein binding
Research Articles on UBASH3B
Similar Products
Product Notes
The UBASH3B ubash3b (Catalog #AAA1277810) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggctcagt acggccaccc cagtccgctc ggcatggctg cgagagagga gctgtacagc aaagtcaccc cccggaggaa ccgccaacag cgccccggca ccatcaagca tggatcggcg ctggacgtgc tcctctccat ggggttcccc agagcccgcg cacaaaaagc cttggcatcc acgggaggaa gaagtgttca ggcagcatgt gactggttat tctcccatgt cggtgacccc ttcctggatg accccctgcc ccgggagtac gtcctctacc tccgtcccac cggcccctta gcacagaagc tttccgactt ttggcagcag tcgaagcaga tctgcgggaa gaacaaggca cacaacatct tcccccacat cacactctgc cagttcttta tgtgcgagga cagcaaggtg gatgccctgg gggaagccct gcagaccacg gtcagtcgct ggaaatgtaa gttctcggcc ccgctgcccc tggagctcta tacgtcgtcc aacttcatcg gcctctttgt aaaggaagac agtgcggagg tcctcaagaa gtttgctgct gactttgctg cagaggctgc atccaaaacc gaagtgcatg tggaacctca taagaagcag ctacatgtga ccctggctta ccacttccaa gccagccacc tacccaccct agagaaactg gcccagaaca ttgacgtcaa gctagggtgt gactgggtgg ctaccatatt ttctcgggat atccgatttg ctaaccatga gacattacag gtcatctacc cctatacccc acaaaatgac gatgagctgg agctggtccc cggggacttc atcttcatgt ctccaatgga gcagaccagc accagcgagg gttggatcta tggcacgtcc ttaaccaccg gctgctctgg actcctgcct gagaattaca ttaccaaggc tgatgaatgc agcacctgga tatttcatgg ttcttattca atcttaaata catcgtcatc caactctctc acgtttgggg atggagtatt ggagaggcgg ccttatgagg accaggggct cggggagacg actcctctta ctatcatctg ccagcccatg cagccgctga gggtcaacag ccagcccggc ccccagaagc gatgcctttt tgtgtgtcgg catggtgaga ggatggatgt tgtgtttggg aagtactggc tgtcccagtg cttcgatgcc aaaggccgct acatacgcac caacctgaac atgcctcata gtttacctca gcggagtggt ggtttccgag attacgagaa agatgctccc atcactgtgt ttggatgcat gcaagcaaga ctagtgggtg aagccttatt agagagcaat accattatcg atcatgtcta ttgctccccg tcccttcgct gcgttcagac tgcacacaat atcttgaaag gtttacaaca agaaaatcac ttgaagatcc gtgtagagcc cggcttattt gagtggacaa aatgggttgc tgggagcaca ttacctgcat ggatacctcc atcagagtta gctgcagcca acctgagtgt tgatacaacc tacagacctc acattccaat cagcaaatta gttgtttcag aatcctatga tacttatatc agtagaagtt tccaagtaac aaaagaaata ataagtgaat gtaaaagtaa aggaaataac atcctgattg tggcccacgc atcttccctt gaagcgtgta cctgccaact tcagggcctg tcacctcaga actccaagga cttcgtacaa atggtccgaa agatcccata tctgggattt tgttcctgtg aagaattagg agaaactgga atatggcagc tgacagatcc accaatcctt cctcttaccc atggaccaac tgggggcttc aactggagag agaccttgct tcaagaataa. It is sometimes possible for the material contained within the vial of "UBASH3B, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
