Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

AK3 cdna clone

AK3 cDNA Clone

Gene Names
AK3; AK6; FIX; AK3L1; AKL3L; AKL3L1
Synonyms
AK3; AK3 cDNA Clone; AK3 cdna clone
Ordering
For Research Use Only!
Sequence
atgggggcgtccgcgcggctgctgcgagcggtgatcatgggggccccgggctcgggcaagggcaccgtgtcgtcgcgcatcactacacacttcgagctgaagcacctctccagcggggacctgctccgggacaacatgctgcggggcacagaaattggcgtgttagccaaggctttcattgaccaagggaaactcatcccagatgatgtcatgactcggctggcccttcatgagctgaaaaatctcacccagtatagctggctgttggatggttttccaaggacacttccacaggcagaagccctagatagagcttatcagatcgacacagtgattaacctgaatgtgccctttgaggtcattaaacaacgccttactgctcgctggattcatcccgccagtggccgagtctataacattgaattcaaccctcccaaaactgtgggcattgatgacctgactggggagcctctcattcagcgtgaggatgataaaccagagacggttatcaagagactaaaggcttatgaagaccaaacaaagccagtcctggaatattaccagaaaaaaggggtgctggaaacattctccggaacagaaaccaacaagatttggccctatgtatatgctttcctacaaactaaagttccacaaagaagccagaaagcttcagttactccatga
Sequence Length
684
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
21,014 Da
NCBI Official Full Name
Homo sapiens adenylate kinase 3, mRNA
NCBI Official Synonym Full Names
adenylate kinase 3
NCBI Official Symbol
AK3
NCBI Official Synonym Symbols
AK6; FIX; AK3L1; AKL3L; AKL3L1
NCBI Protein Information
GTP:AMP phosphotransferase AK3, mitochondrial
UniProt Protein Name
GTP:AMP phosphotransferase AK3, mitochondrial
UniProt Gene Name
AK3
UniProt Synonym Gene Names
AK 3
UniProt Entry Name
KAD3_HUMAN

NCBI Description

The protein encoded by this gene is a GTP:ATP phosphotransferase that is found in the mitochondrial matrix. Several transcript variants encoding a few different isoforms have been found for this gene. [provided by RefSeq, Dec 2010]

Uniprot Description

AK3: is a GTP:ATP phosphotransferase that is found in the mitochondrial matrix. Several transcript variants encoding a few different isoforms have been found for this gene. [provided by RefSeq, Dec 2010]

Protein type: EC 2.7.4.10; Mitochondrial; Nucleotide Metabolism - pyrimidine; Transferase

Chromosomal Location of Human Ortholog: 9p24.1

Cellular Component: mitochondrial matrix; mitochondrion

Molecular Function: adenylate kinase activity; nucleoside triphosphate adenylate kinase activity; protein binding

Biological Process: AMP metabolic process; blood coagulation; GTP metabolic process; ITP metabolic process; UTP metabolic process

Research Articles on AK3

Similar Products

Product Notes

The AK3 ak3 (Catalog #AAA1277807) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggggcgt ccgcgcggct gctgcgagcg gtgatcatgg gggccccggg ctcgggcaag ggcaccgtgt cgtcgcgcat cactacacac ttcgagctga agcacctctc cagcggggac ctgctccggg acaacatgct gcggggcaca gaaattggcg tgttagccaa ggctttcatt gaccaaggga aactcatccc agatgatgtc atgactcggc tggcccttca tgagctgaaa aatctcaccc agtatagctg gctgttggat ggttttccaa ggacacttcc acaggcagaa gccctagata gagcttatca gatcgacaca gtgattaacc tgaatgtgcc ctttgaggtc attaaacaac gccttactgc tcgctggatt catcccgcca gtggccgagt ctataacatt gaattcaacc ctcccaaaac tgtgggcatt gatgacctga ctggggagcc tctcattcag cgtgaggatg ataaaccaga gacggttatc aagagactaa aggcttatga agaccaaaca aagccagtcc tggaatatta ccagaaaaaa ggggtgctgg aaacattctc cggaacagaa accaacaaga tttggcccta tgtatatgct ttcctacaaa ctaaagttcc acaaagaagc cagaaagctt cagttactcc atga. It is sometimes possible for the material contained within the vial of "AK3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.