Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

VPS4A cdna clone

VPS4A cDNA Clone

Gene Names
VPS4A; SKD1; SKD2; VPS4; SKD1A; VPS4-1
Synonyms
VPS4A; VPS4A cDNA Clone; VPS4A cdna clone
Ordering
For Research Use Only!
Sequence
atgacaacgtcaaccctccagaaagccattgatctggtgacgaaagccacagaggaggacaaagccaagaactacgaggaggcgctgcggctgtaccagcatgcggtggagtacttcctccacgctatcaagtatgaggcccacagcgacaaggccaaggagagcattcgagccaagtgcgtgcagtacctagaccgggccgagaagctgaaggattatttacgaagcaaagagaaacacggcaagaagccagtcaaagagaaccagagtgagggcaagggcagtgacagtgacagtgaaggggataatccggagaaaaagaaactgcaagaacagctgatgggtgccgtcgtgatggagaagcccaacatacggtggaacgacgtggccgggctggagggggccaaggaggccctcaaagaagctgtcattttgccaatcaaattcccacacttgttcacaggcaagcgcaccccctggcgggggattctgctgttcggaccccctggcacagggaaatcctacctggccaaagccgtggcaacagaggccaacaactccaccttcttctctgtgtcctcctcagatctgatgtccaagtggctgggggagagtgaaaagctggtcaagaacctgtttgagctggccaggcagcacaagccctccatcatcttcatcgatgaggtggattccctctgcgggtcccgaaatgaaaatgagagtgaggccgcccggaggatcaaaacggagttcttggtccagatgcagggggtggggaataacaatgatgggactctggttcttggagccacaaacatcccatgggtgttggattcggccatcaggaggaggtttgaaaaacgaatttatatccccttgccggaggaagctgcccgcgcccagatgttccggttgcatctcgggagcactccccacaacctcacggatgcaaacatccacgagctggcccggaagacggaaggctactcgggcgcggacatcagcatcatcgtgcgggactctctcatgcagcccgtgaggaaggtgcagtcggccacacacttcaaaaaggtctgtggcccctctcgcaccaaccccagcatgatgattgatgacctcctgactccatgctcaccaggggacccaggagccatggagatgacttggatggatgtccctggggacaaactcttagagcctgtggtttgcatgtcggacatgctgcggtctctggccaccacccggcccacggtgaatgcagacgacctcctgaaagtgaagaaattctcagaggactttgggcaagagagttaa
Sequence Length
1314
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
48,898 Da
NCBI Official Full Name
Homo sapiens vacuolar protein sorting 4 homolog A (S. cerevisiae), mRNA
NCBI Official Synonym Full Names
vacuolar protein sorting 4 homolog A
NCBI Official Symbol
VPS4A
NCBI Official Synonym Symbols
SKD1; SKD2; VPS4; SKD1A; VPS4-1
NCBI Protein Information
vacuolar protein sorting-associated protein 4A
UniProt Protein Name
Vacuolar protein sorting-associated protein 4A
UniProt Gene Name
VPS4A
UniProt Synonym Gene Names
hVPS4
UniProt Entry Name
VPS4A_HUMAN

NCBI Description

The protein encoded by this gene is a member of the AAA protein family (ATPases associated with diverse cellular activities), and is the homolog of the yeast Vps4 protein. In humans, two paralogs of the yeast protein have been identified. The former share a high degree of aa sequence similarity with each other, and also with yeast Vps4 and mouse Skd1 proteins. The mouse Skd1 (suppressor of K+ transport defect 1) has been shown to be really an yeast Vps4 ortholog. Functional studies indicate that both human paralogs associate with the endosomal compartments, and are involved in intracellular protein trafficking, similar to Vps4 protein in yeast. The gene encoding this paralog has been mapped to chromosome 16; the gene for the other resides on chromosome 18. [provided by RefSeq, Jul 2008]

Uniprot Description

VPS4A: Involved in late steps of the endosomal multivesicular bodies (MVB) pathway. Recognizes membrane-associated ESCRT-III assemblies and catalyzes their disassembly, possibly in combination with membrane fission. Redistributes the ESCRT-III components to the cytoplasm for further rounds of MVB sorting. MVBs contain intraluminal vesicles (ILVs) that are generated by invagination and scission from the limiting membrane of the endosome and mostly are delivered to lysosomes enabling degradation of membrane proteins, such as stimulated growth factor receptors, lysosomal enzymes and lipids. In conjunction with the ESCRT machinery also appears to function in topologically equivalent membrane fission events, such as the terminal stages of cytokinesis and enveloped virus budding (HIV-1 and other lentiviruses). Involved in cytokinesis. Belongs to the AAA ATPase family.

Protein type: EC 3.6.4.6; Vesicle

Chromosomal Location of Human Ortholog: 16q22.1

Cellular Component: centrosome; cytoplasm; cytosol; early endosome; endosome; late endosome; lysosome; midbody; nucleus; perinuclear region of cytoplasm; plasma membrane; spindle pole; vacuolar membrane

Molecular Function: ATP binding; ATPase activity; microtubule-severing ATPase activity; protein binding; protein C-terminus binding; protein domain specific binding

Biological Process: abscission; cell division; cell separation during cytokinesis; cytoplasmic microtubule organization and biogenesis; endosomal vesicle fusion; endosome transport; intracellular cholesterol transport; membrane budding; mitotic metaphase plate congression; negative regulation of cytokinesis; nuclear organization and biogenesis; regulation of protein localization; release of virus from host; ubiquitin-dependent protein catabolic process via the multivesicular body pathway; vacuole organization and biogenesis; vesicle-mediated transport; viral infectious cycle

Research Articles on VPS4A

Similar Products

Product Notes

The VPS4A vps4a (Catalog #AAA1277799) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgacaacgt caaccctcca gaaagccatt gatctggtga cgaaagccac agaggaggac aaagccaaga actacgagga ggcgctgcgg ctgtaccagc atgcggtgga gtacttcctc cacgctatca agtatgaggc ccacagcgac aaggccaagg agagcattcg agccaagtgc gtgcagtacc tagaccgggc cgagaagctg aaggattatt tacgaagcaa agagaaacac ggcaagaagc cagtcaaaga gaaccagagt gagggcaagg gcagtgacag tgacagtgaa ggggataatc cggagaaaaa gaaactgcaa gaacagctga tgggtgccgt cgtgatggag aagcccaaca tacggtggaa cgacgtggcc gggctggagg gggccaagga ggccctcaaa gaagctgtca ttttgccaat caaattccca cacttgttca caggcaagcg caccccctgg cgggggattc tgctgttcgg accccctggc acagggaaat cctacctggc caaagccgtg gcaacagagg ccaacaactc caccttcttc tctgtgtcct cctcagatct gatgtccaag tggctggggg agagtgaaaa gctggtcaag aacctgtttg agctggccag gcagcacaag ccctccatca tcttcatcga tgaggtggat tccctctgcg ggtcccgaaa tgaaaatgag agtgaggccg cccggaggat caaaacggag ttcttggtcc agatgcaggg ggtggggaat aacaatgatg ggactctggt tcttggagcc acaaacatcc catgggtgtt ggattcggcc atcaggagga ggtttgaaaa acgaatttat atccccttgc cggaggaagc tgcccgcgcc cagatgttcc ggttgcatct cgggagcact ccccacaacc tcacggatgc aaacatccac gagctggccc ggaagacgga aggctactcg ggcgcggaca tcagcatcat cgtgcgggac tctctcatgc agcccgtgag gaaggtgcag tcggccacac acttcaaaaa ggtctgtggc ccctctcgca ccaaccccag catgatgatt gatgacctcc tgactccatg ctcaccaggg gacccaggag ccatggagat gacttggatg gatgtccctg gggacaaact cttagagcct gtggtttgca tgtcggacat gctgcggtct ctggccacca cccggcccac ggtgaatgca gacgacctcc tgaaagtgaa gaaattctca gaggactttg ggcaagagag ttaa. It is sometimes possible for the material contained within the vial of "VPS4A, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.