Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CCL13 cdna clone

CCL13 cDNA Clone

Gene Names
CCL13; NCC1; CKb10; MCP-4; NCC-1; SCYL1; SCYA13
Synonyms
CCL13; CCL13 cDNA Clone; CCL13 cdna clone
Ordering
For Research Use Only!
Sequence
atgaaagtctctgcagtgcttctgtgcctgctgctcatgacagcagctttcaacccccagggacttgctcagccagatgcactcaacgtcccatctacttgctgcttcacatttagcagtaagaagatctccttgcagaggctgaagagctatgtgatcaccaccagcaggtgtccccagaaggctgtcatcttcagaaccaaactgggcaaggagatctgtgctgacccaaaggagaagtgggtccagaattatatgaaacacctgggccggaaagctcacaccctgaagacttga
Sequence Length
297
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
10,986 Da
NCBI Official Full Name
Homo sapiens chemokine (C-C motif) ligand 13, mRNA
NCBI Official Synonym Full Names
C-C motif chemokine ligand 13
NCBI Official Symbol
CCL13
NCBI Official Synonym Symbols
NCC1; CKb10; MCP-4; NCC-1; SCYL1; SCYA13
NCBI Protein Information
C-C motif chemokine 13
UniProt Protein Name
C-C motif chemokine 13
Protein Family
UniProt Gene Name
CCL13
UniProt Synonym Gene Names
MCP4; NCC1; SCYA13; MCP-4
UniProt Entry Name
CCL13_HUMAN

NCBI Description

This antimicrobial gene is one of several Cys-Cys (CC) cytokine genes clustered on the q-arm of chromosome 17. Cytokines are a family of secreted proteins involved in immunoregulatory and inflammatory processes. The CC cytokines are proteins characterized by two adjacent cysteines. The cytokine encoded by this gene displays chemotactic activity for monocytes, lymphocytes, basophils and eosinophils, but not neutrophils. This chemokine plays a role in accumulation of leukocytes during inflammation. It may also be involved in the recruitment of monocytes into the arterial wall during artherosclerosis. [provided by RefSeq, Sep 2014]

Uniprot Description

CCL13: Chemotactic factor that attracts monocytes, lymphocytes, basophils and eosinophils, but not neutrophils. Signals through CCR2B and CCR3 receptors. Plays a role in the accumulation of leukocytes at both sides of allergic and non-allergic inflammation. May be involved in the recruitment of monocytes into the arterial wall during the disease process of atherosclerosis. May play a role in the monocyte attraction in tissues chronically exposed to exogenous pathogens. By IL1/interleukin-1 and TNF. Widely expressed. Found in small intestine, thymus, colon, lung, trachea, stomach and lymph node. Low levels seen in the pulmonary artery smooth muscle cells. Belongs to the intercrine beta (chemokine CC) family.

Protein type: Motility/polarity/chemotaxis; Secreted, signal peptide; Secreted; Chemokine

Chromosomal Location of Human Ortholog: 17q11.2

Molecular Function: CCR chemokine receptor binding; chemokine activity; receptor binding

Biological Process: cell-cell signaling; cellular calcium ion homeostasis; chemotaxis; cytoskeleton organization and biogenesis; eosinophil chemotaxis; G-protein coupled receptor protein signaling pathway; lymphocyte chemotaxis; monocyte chemotaxis; neutrophil chemotaxis; positive regulation of GTPase activity; positive regulation of inflammatory response; regulation of cell shape; signal transduction

Research Articles on CCL13

Similar Products

Product Notes

The CCL13 ccl13 (Catalog #AAA1277787) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaaagtct ctgcagtgct tctgtgcctg ctgctcatga cagcagcttt caacccccag ggacttgctc agccagatgc actcaacgtc ccatctactt gctgcttcac atttagcagt aagaagatct ccttgcagag gctgaagagc tatgtgatca ccaccagcag gtgtccccag aaggctgtca tcttcagaac caaactgggc aaggagatct gtgctgaccc aaaggagaag tgggtccaga attatatgaa acacctgggc cggaaagctc acaccctgaa gacttga. It is sometimes possible for the material contained within the vial of "CCL13, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.