Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PPP1R7 cdna clone

PPP1R7 cDNA Clone

Gene Names
PPP1R7; SDS22
Synonyms
PPP1R7; PPP1R7 cDNA Clone; PPP1R7 cdna clone
Ordering
For Research Use Only!
Sequence
atggcggcggaacgcggcgcggggcagcaacagtcgcaggagatgatggaggttgacaggcgggtcgagtctgaagaatccggcgatgaagaagggaagaaacacagcagtggcatcgtggccgacctcagtgaacagagcctgaaggatggggaggagcggggggaggaggacccagaagaagaacatgagctgcctgtggacatggaaaccatcaacctggacagagatgcagaggatgttgatttgaatcactatcgcatagggaagattgaaggatttgaggtactgaagaaagtgaagactctctgcctccgccaaaatttaattaaatgcattgagaatctggaggagctacagagtcttcgagagctggatctttacgacaaccagatcaagaagattgagaatctggaggcgctaacagagctggagattctagatatttcttttaatctgctgagaaacatcgaaggggttgacaagttgacacgactgaaaaaactcttcttggtcaacaataaaatcagtaaaattgagaacttaagcaacttacatcaactacagatgctagagctgggatctaaccgcatccgggcaatcgaaaatatcgacaccttaaccaacctggagagtttgtttttggggaaaaacaaaattactaaacttcagaacctggatgcgctcaccaacctgacagtcctcagtatgcagagcaaccggctgaccaagatcgagggtctgcagaacctggtgaacctgcgggagctgtaccttagccacaatggcatcgaggtcatcgagggcctggagaacaatgtgcaggacagcctcacgtactga
Sequence Length
843
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
25,593 Da
NCBI Official Full Name
Homo sapiens protein phosphatase 1, regulatory (inhibitor) subunit 7, mRNA
NCBI Official Synonym Full Names
protein phosphatase 1 regulatory subunit 7
NCBI Official Symbol
PPP1R7
NCBI Official Synonym Symbols
SDS22
NCBI Protein Information
protein phosphatase 1 regulatory subunit 7
UniProt Protein Name
Protein phosphatase 1 regulatory subunit 7
UniProt Gene Name
PPP1R7
UniProt Synonym Gene Names
SDS22
UniProt Entry Name
PP1R7_HUMAN

NCBI Description

This gene encodes a protein subunit that regulates the activity of the serine/threonine phosphatase, protein phosphatase-1. The encoded protein is required for completion of the mitotic cycle and for targeting protein phosphatase-1 to mitotic kinetochores. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]

Uniprot Description

PPP1R7: Regulatory subunit of protein phosphatase 1. Belongs to the SDS22 family. 4 isoforms of the human protein are produced by alternative splicing.

Protein type: Protein phosphatase, regulatory subunit; Motility/polarity/chemotaxis

Chromosomal Location of Human Ortholog: 2q37.3

Cellular Component: chromosome; cytoplasm; nucleus

Molecular Function: protein binding; protein phosphatase type 1 regulator activity

Biological Process: positive regulation of protein amino acid dephosphorylation

Research Articles on PPP1R7

Similar Products

Product Notes

The PPP1R7 ppp1r7 (Catalog #AAA1277764) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcggcgg aacgcggcgc ggggcagcaa cagtcgcagg agatgatgga ggttgacagg cgggtcgagt ctgaagaatc cggcgatgaa gaagggaaga aacacagcag tggcatcgtg gccgacctca gtgaacagag cctgaaggat ggggaggagc ggggggagga ggacccagaa gaagaacatg agctgcctgt ggacatggaa accatcaacc tggacagaga tgcagaggat gttgatttga atcactatcg catagggaag attgaaggat ttgaggtact gaagaaagtg aagactctct gcctccgcca aaatttaatt aaatgcattg agaatctgga ggagctacag agtcttcgag agctggatct ttacgacaac cagatcaaga agattgagaa tctggaggcg ctaacagagc tggagattct agatatttct tttaatctgc tgagaaacat cgaaggggtt gacaagttga cacgactgaa aaaactcttc ttggtcaaca ataaaatcag taaaattgag aacttaagca acttacatca actacagatg ctagagctgg gatctaaccg catccgggca atcgaaaata tcgacacctt aaccaacctg gagagtttgt ttttggggaa aaacaaaatt actaaacttc agaacctgga tgcgctcacc aacctgacag tcctcagtat gcagagcaac cggctgacca agatcgaggg tctgcagaac ctggtgaacc tgcgggagct gtaccttagc cacaatggca tcgaggtcat cgagggcctg gagaacaatg tgcaggacag cctcacgtac tga. It is sometimes possible for the material contained within the vial of "PPP1R7, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.