Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

EPHA7 cdna clone

EPHA7 cDNA Clone

Gene Names
EPHA7; EHK3; EK11; EHK-3; HEK11
Synonyms
EPHA7; EPHA7 cDNA Clone; EPHA7 cdna clone
Ordering
For Research Use Only!
Sequence
atggtttttcaaactcggtacccttcatggattattttatgctacatctggctgctccgctttgcacacacaggggaggcgcaggctgcgaaggaagtactactgctggattctaaagcacaacaaacagagttggagtggatttcctctccacccaatgggtgggaagaaattagtggtttggatgagaactataccccgatacgaacataccaggtgtgccaagtcatggagcccaaccaaaacaactggctgcggactaactggatttccaaaggcaatgcacaaaggatttttgtagaattgaaattcaccctgagggattgtaacagtcttcctggagtactgggaacttgcaaggaaacatttaatttgtactattatgaaacagactatgacactggcaggaatgtaagagaaaacctctatgtaaaaatagacaccattgctgcagatgaaagttttacccaaggtgaccttggtgaaagaaagatgaagcttaacactgaggtgagagagattggacctttgtccaaaaagggattctatcttgcctttcaggatgtaggggcttgcatagctttggtttctgtcaaagtgtactacaagaagtgctggtccattattgagaacttagctatctttccagatacagtgactggttcagaattttcctctttagtcgaggttcgagggacatgtgtcagcagtgcagaggaagaagcggaaaacgcccccaggatgcactgcagtgcagaaggagaatggttagtgcccattggaaaatgtatctgcaaagcaggctaccagcaaaaaggagacacttgtgaatgtaagtaa
Sequence Length
840
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
50,521 Da
NCBI Official Full Name
Homo sapiens EPH receptor A7, mRNA
NCBI Official Synonym Full Names
EPH receptor A7
NCBI Official Symbol
EPHA7
NCBI Official Synonym Symbols
EHK3; EK11; EHK-3; HEK11
NCBI Protein Information
ephrin type-A receptor 7
UniProt Protein Name
Ephrin type-A receptor 7
Protein Family
UniProt Gene Name
EPHA7
UniProt Synonym Gene Names
EHK3; HEK11; EHK-3; EK11; hEK11
UniProt Entry Name
EPHA7_HUMAN

NCBI Description

This gene belongs to the ephrin receptor subfamily of the protein-tyrosine kinase family. EPH and EPH-related receptors have been implicated in mediating developmental events, particularly in the nervous system. Receptors in the EPH subfamily typically have a single kinase domain and an extracellular region containing a Cys-rich domain and 2 fibronectin type III repeats. The ephrin receptors are divided into 2 groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. Increased expression of this gene is associated with multiple forms of carcinoma. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]

Uniprot Description

EphA7: a widely-expressed receptor tyrosine kinase of the Eph family. Receptor for members of the ephrin-A family. Binds to ephrin-A1, -A2, -A3, -A4 and -A5. Contains 1 sterile alpha motif (SAM) and two fibronectin type III domains.

Protein type: Protein kinase, TK; Kinase, protein; Membrane protein, integral; EC 2.7.10.1; Protein kinase, tyrosine (receptor); TK group; Eph family

Chromosomal Location of Human Ortholog: 6q16.1

Cellular Component: plasma membrane

Molecular Function: axon guidance receptor activity; chemorepellent activity; GPI-linked ephrin receptor activity; protein binding; protein-tyrosine kinase activity

Biological Process: brain development; branching morphogenesis of a nerve; ephrin receptor signaling pathway; negative chemotaxis; phosphorylation; positive regulation of neuron apoptosis; regulation of caspase activity; regulation of cell-cell adhesion; regulation of peptidyl-tyrosine phosphorylation; regulation of protein amino acid autophosphorylation

Research Articles on EPHA7

Similar Products

Product Notes

The EPHA7 epha7 (Catalog #AAA1277762) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggtttttc aaactcggta cccttcatgg attattttat gctacatctg gctgctccgc tttgcacaca caggggaggc gcaggctgcg aaggaagtac tactgctgga ttctaaagca caacaaacag agttggagtg gatttcctct ccacccaatg ggtgggaaga aattagtggt ttggatgaga actatacccc gatacgaaca taccaggtgt gccaagtcat ggagcccaac caaaacaact ggctgcggac taactggatt tccaaaggca atgcacaaag gatttttgta gaattgaaat tcaccctgag ggattgtaac agtcttcctg gagtactggg aacttgcaag gaaacattta atttgtacta ttatgaaaca gactatgaca ctggcaggaa tgtaagagaa aacctctatg taaaaataga caccattgct gcagatgaaa gttttaccca aggtgacctt ggtgaaagaa agatgaagct taacactgag gtgagagaga ttggaccttt gtccaaaaag ggattctatc ttgcctttca ggatgtaggg gcttgcatag ctttggtttc tgtcaaagtg tactacaaga agtgctggtc cattattgag aacttagcta tctttccaga tacagtgact ggttcagaat tttcctcttt agtcgaggtt cgagggacat gtgtcagcag tgcagaggaa gaagcggaaa acgcccccag gatgcactgc agtgcagaag gagaatggtt agtgcccatt ggaaaatgta tctgcaaagc aggctaccag caaaaaggag acacttgtga atgtaagtaa. It is sometimes possible for the material contained within the vial of "EPHA7, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.