Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ANKHD1 cdna clone

ANKHD1 cDNA Clone

Gene Names
ANKHD1; MASK; MASK1; VBARP; PP2500
Synonyms
ANKHD1; ANKHD1 cDNA Clone; ANKHD1 cdna clone
Ordering
For Research Use Only!
Sequence
atgctgactgatagcggaggcggcggcacctcctttgaggaggacctggactctgtggctccgcgatccgccccagctggggcctcggagccgcctccgccgggaggggtcggtctggggatccgcaccgtgaggctctttggggaggccgggccagcgtcgggagtcggcagcagcggcggcggcggcagcggcagcggtacgggcggaggggacgcggcgctggatttcaagttggcggctgccgtgctgaggaccgggggtggaggtggtgcctctggcagtgacgaggacgaagtgtccgaggttgaatcatttattttggaccaagaagatctggataacccagtgcttaaaacaacatcagagatattcttatcaagtactgcagaaggagcagacttacgcactgtggatccagagacacaggcacgactagaagcattgctagaagcagcagcttttgcagatcctgaggtactccggagactgacatcctcagttagttgtgcactggatgaagctgctgctgcactgacacggatgaaagcagaaaacagccacaatgcaggacaagtggacactcgcagtctagcagaagcttgttcagatggggatgttaatgctgttcgtaaattgctagatgaaggcagaagtgtaaatgaacatacagaagaaggagaaagcctgctgtgtttggcttgttcagcagggtattatgaattagcacaagtattgcttgctatgcatgctaatgttgaagatcgagggaataaaggagacataactcccctgatggcagcttccagtggaggttacttagatattgtgaaattattacttcttcatgatgctgatgtcaactcccagtctgcaacaggaaacactgcgctaacttatgcatgtgctggaggatttgttgacattgttaaagtgctccttaatgaaggtgcaaatatagaagatcataatgaaaatggacatactcccttaatggaagcagccagtgcaggtcatgtggaagttgcaagagttcttttagatcatggtgcaggcatcaacactcattctaatgaattcaaagaaagtgctctaacacttgcttgctacaaaggccatttggatatggttcgctttctacttgaagctggtgcagatcaagagcacaaaacagatgagatgcacactgccttaatggaggcctgcatggatggacatgtagaggtggcacgtttgcttttggatagtggtgctcaagtgaacatgcctgcagattcatttgaatctccattgacgctagctgcctgtggaggacatgttgaattggcagctctacttattgaaaggggagcaaatcttgaagaagttaatgatgaaggatacactcccttgatggaagctgcccgggaaggacatgaagaaatggtggcactactcttagcacaaggagcaaatataaatgcccagacagaagaaactcaagaaactgctcttactttggcttgctgtggaggattttctgaagttgcagactttcttattaaggcaggggctgatatagaacttggctgctccacacctctgatggaggcatctcaggagggacacctggaattggttaaatatttgctggcttctggcgctaatgtgcatgctacaacagcaacaggagacacagccttaacctatgcttgtgaaaatggacatacggatgttgcagatgttttacttcaagcaggggctgatttagacaagcaggaggacatgaagactattttggagggcatagatccggccaagcatcaggtgagggtggcctttgatgcttgtaagctactacgtaaagaatag
Sequence Length
1851
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
277,175 Da
NCBI Official Full Name
Homo sapiens ankyrin repeat and KH domain containing 1, mRNA
NCBI Official Synonym Full Names
ankyrin repeat and KH domain containing 1
NCBI Official Symbol
ANKHD1
NCBI Official Synonym Symbols
MASK; MASK1; VBARP; PP2500
NCBI Protein Information
ankyrin repeat and KH domain-containing protein 1
UniProt Protein Name
Ankyrin repeat and KH domain-containing protein 1
UniProt Gene Name
ANKHD1
UniProt Synonym Gene Names
KIAA1085; MASK; VBARP; hMASK
UniProt Entry Name
ANKH1_HUMAN

NCBI Description

This gene encodes a protein with multiple ankyrin repeat domains and a single KH-domain. The protein is thought to function as a scaffolding protein, and it may be involved in the regulation of caspases and thereby play an antiapoptotic role in cell survival. Alternative splicing results in multiple transcript variants, one of which generates a fusion transcript (MASK-BP3) with the downstream eIF4E-binding protein 3 (EIF4EBP3) gene, resulting in a protein comprised of the ANKHD1 sequence for the majority of the protein and a different C-terminus due to an alternate reading frame for the EIF4EBP3 segments. [provided by RefSeq, Sep 2010]

Uniprot Description

ANKHD1: May play a role as a scaffolding protein that may be associated with the abnormal phenotype of leukemia cells. Isoform 2 may possess an antiapoptotic effect and protect cells during normal cell survival through its regulation of caspases. Belongs to the mask family. 6 isoforms of the human protein are produced by alternative splicing.

Protein type: Apoptosis; RNA-binding

Chromosomal Location of Human Ortholog: 5q31.3

Cellular Component: cytoplasm; nucleoplasm

Molecular Function: protein binding

Biological Process: innate immune response

Research Articles on ANKHD1

Similar Products

Product Notes

The ANKHD1 ankhd1 (Catalog #AAA1277751) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgctgactg atagcggagg cggcggcacc tcctttgagg aggacctgga ctctgtggct ccgcgatccg ccccagctgg ggcctcggag ccgcctccgc cgggaggggt cggtctgggg atccgcaccg tgaggctctt tggggaggcc gggccagcgt cgggagtcgg cagcagcggc ggcggcggca gcggcagcgg tacgggcgga ggggacgcgg cgctggattt caagttggcg gctgccgtgc tgaggaccgg gggtggaggt ggtgcctctg gcagtgacga ggacgaagtg tccgaggttg aatcatttat tttggaccaa gaagatctgg ataacccagt gcttaaaaca acatcagaga tattcttatc aagtactgca gaaggagcag acttacgcac tgtggatcca gagacacagg cacgactaga agcattgcta gaagcagcag cttttgcaga tcctgaggta ctccggagac tgacatcctc agttagttgt gcactggatg aagctgctgc tgcactgaca cggatgaaag cagaaaacag ccacaatgca ggacaagtgg acactcgcag tctagcagaa gcttgttcag atggggatgt taatgctgtt cgtaaattgc tagatgaagg cagaagtgta aatgaacata cagaagaagg agaaagcctg ctgtgtttgg cttgttcagc agggtattat gaattagcac aagtattgct tgctatgcat gctaatgttg aagatcgagg gaataaagga gacataactc ccctgatggc agcttccagt ggaggttact tagatattgt gaaattatta cttcttcatg atgctgatgt caactcccag tctgcaacag gaaacactgc gctaacttat gcatgtgctg gaggatttgt tgacattgtt aaagtgctcc ttaatgaagg tgcaaatata gaagatcata atgaaaatgg acatactccc ttaatggaag cagccagtgc aggtcatgtg gaagttgcaa gagttctttt agatcatggt gcaggcatca acactcattc taatgaattc aaagaaagtg ctctaacact tgcttgctac aaaggccatt tggatatggt tcgctttcta cttgaagctg gtgcagatca agagcacaaa acagatgaga tgcacactgc cttaatggag gcctgcatgg atggacatgt agaggtggca cgtttgcttt tggatagtgg tgctcaagtg aacatgcctg cagattcatt tgaatctcca ttgacgctag ctgcctgtgg aggacatgtt gaattggcag ctctacttat tgaaagggga gcaaatcttg aagaagttaa tgatgaagga tacactccct tgatggaagc tgcccgggaa ggacatgaag aaatggtggc actactctta gcacaaggag caaatataaa tgcccagaca gaagaaactc aagaaactgc tcttactttg gcttgctgtg gaggattttc tgaagttgca gactttctta ttaaggcagg ggctgatata gaacttggct gctccacacc tctgatggag gcatctcagg agggacacct ggaattggtt aaatatttgc tggcttctgg cgctaatgtg catgctacaa cagcaacagg agacacagcc ttaacctatg cttgtgaaaa tggacatacg gatgttgcag atgttttact tcaagcaggg gctgatttag acaagcagga ggacatgaag actattttgg agggcataga tccggccaag catcaggtga gggtggcctt tgatgcttgt aagctactac gtaaagaata g. It is sometimes possible for the material contained within the vial of "ANKHD1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.