Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SNAP23 cdna clone

SNAP23 cDNA Clone

Gene Names
SNAP23; SNAP-23; SNAP23A; SNAP23B; HsT17016
Synonyms
SNAP23; SNAP23 cDNA Clone; SNAP23 cdna clone
Ordering
For Research Use Only!
Sequence
atggataatctgtcatcagaagaaattcaacagagagctcaccagattactgatgagtctctggaaagtacgaggagaatcctgggtttagccattgagtctcaggatgcaggaatcaagaccatcactatgctggatgaacaaaaggaacaactaaaccgcatagaagaaggcttggaccaaataaataaggacatgagagagacagagaagactttaacagaactcaacaaatgctgtggcctttgtgtctgcccatgtaatagaacaaagaactttgagtctggcaaggcttataagacaacatggggagatggtggagaaaactcaccttgcaatgtagtatctaaacagccaggcccggtgacaaatggtcagcttcagcaaccaacaacgggagcagccagtggtggatacattaaacgcataactaatgatgccagagaagatgaaatggaagagaacctgactcaagtgggcagtatcctgggaaatctaaaagacatggccctgaacataggcaatgagattgatgctcaaaatccacaaataaaacgaatcacagacaaggctgacaccaacagagatcgtattgatattgccaatgccagagcaaagaaactcattgacagctaa
Sequence Length
636
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
17,789 Da
NCBI Official Full Name
Homo sapiens synaptosomal-associated protein, 23kDa, mRNA
NCBI Official Synonym Full Names
synaptosome associated protein 23
NCBI Official Symbol
SNAP23
NCBI Official Synonym Symbols
SNAP-23; SNAP23A; SNAP23B; HsT17016
NCBI Protein Information
synaptosomal-associated protein 23
UniProt Protein Name
Synaptosomal-associated protein 23
UniProt Gene Name
SNAP23
UniProt Synonym Gene Names
SNAP-23
UniProt Entry Name
SNP23_HUMAN

NCBI Description

Specificity of vesicular transport is regulated, in part, by the interaction of a vesicle-associated membrane protein termed synaptobrevin/VAMP with a target compartment membrane protein termed syntaxin. These proteins, together with SNAP25 (synaptosome-associated protein of 25 kDa), form a complex which serves as a binding site for the general membrane fusion machinery. Synaptobrevin/VAMP and syntaxin are believed to be involved in vesicular transport in most, if not all cells, while SNAP25 is present almost exclusively in the brain, suggesting that a ubiquitously expressed homolog of SNAP25 exists to facilitate transport vesicle/target membrane fusion in other tissues. The protein encoded by this gene is structurally and functionally similar to SNAP25 and binds tightly to multiple syntaxins and synaptobrevins/VAMPs. It is an essential component of the high affinity receptor for the general membrane fusion machinery and is an important regulator of transport vesicle docking and fusion. Two alternative transcript variants encoding different protein isoforms have been described for this gene. [provided by RefSeq, Jul 2008]

Uniprot Description

SNAP23: a member of the SNAP-25 family of SNARE proteins. Structurally and functionally similar to SNAP25 and binds tightly to multiple syntaxins and synaptobrevins/VAMPs. It is an essential component of the high affinity receptor for the general membrane fusion machinery and is an important regulator of transport vesicle docking and fusion. Two alternatively spliced isoforms have been described.

Protein type: Vesicle

Chromosomal Location of Human Ortholog: 15q14

Cellular Component: azurophil granule; cytoplasm; focal adhesion; intercellular junction; nucleoplasm; plasma membrane; SNARE complex; specific granule

Molecular Function: protein binding; SNAP receptor activity; syntaxin binding

Biological Process: histamine secretion by mast cell; post-Golgi vesicle-mediated transport; synaptic vesicle fusion to presynaptic membrane; synaptic vesicle priming; vesicle targeting

Research Articles on SNAP23

Similar Products

Product Notes

The SNAP23 snap23 (Catalog #AAA1277738) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggataatc tgtcatcaga agaaattcaa cagagagctc accagattac tgatgagtct ctggaaagta cgaggagaat cctgggttta gccattgagt ctcaggatgc aggaatcaag accatcacta tgctggatga acaaaaggaa caactaaacc gcatagaaga aggcttggac caaataaata aggacatgag agagacagag aagactttaa cagaactcaa caaatgctgt ggcctttgtg tctgcccatg taatagaaca aagaactttg agtctggcaa ggcttataag acaacatggg gagatggtgg agaaaactca ccttgcaatg tagtatctaa acagccaggc ccggtgacaa atggtcagct tcagcaacca acaacgggag cagccagtgg tggatacatt aaacgcataa ctaatgatgc cagagaagat gaaatggaag agaacctgac tcaagtgggc agtatcctgg gaaatctaaa agacatggcc ctgaacatag gcaatgagat tgatgctcaa aatccacaaa taaaacgaat cacagacaag gctgacacca acagagatcg tattgatatt gccaatgcca gagcaaagaa actcattgac agctaa. It is sometimes possible for the material contained within the vial of "SNAP23, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.