Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

TSEN34 cdna clone

TSEN34 cDNA Clone

Gene Names
TSEN34; LENG5; PCH2C; SEN34; SEN34L
Synonyms
TSEN34; TSEN34 cDNA Clone; TSEN34 cdna clone
Ordering
For Research Use Only!
Sequence
atgctggtggtggaggtggcgaacggccgctccctggtgtggggagccgaggcggtgcaggccctccgggagcgcctgggtgtggggggccgcacggtaggcgccctgccccgcgggccccgccagaactcgcgcctgggcctcccgctgctgctgatgcccgaagaggcgcggctcttggccgagatcggcgccgtgactctggtcagcgccccgcgtccagactctcggcaccacagcctggccctgacatccttcaagcgccagcaagaggagagcttccaggagcagagcgccttggcagctgaggcccgggagacccgtcgtcaggaggtcctggagaagattacggagggccaggctgctaagaagcagaaactagaacaggcttcaggggccagctcaagccaggaggccggctcgagccaggctgccaaagaggatgagaccagtgatggccaggcttcgggagagcaggaggaagctggcccctcgtcttcccaagcaggaccctcaaatggggtagcccccttgcccagatctgctctccttgtccagctggccactgccaggcctcgaccggtcaaggccaggcccctggactggcgtgtccagtctaaagactggccccacgccggccgccctgcccacgagctgcgctacagtatctacagagacctgtgggagcgaggcttcttcctcagtgcggctggcaagttcggaggtgacttcctggtctatcctggtgaccccctccgcttccacgcccattatatcgctcagtgctgggcccctgaggacacctcccactccaagacctggttgctgctgggcgccttggaaccagcgtcagaaagaccctgctcctctgttctccgcagcctgatggtaaggtggtctacacctccctgcaatgggccagcctgcagtgaactccagagacctaggggatgtggctgtgtcggcagcaagagcctttctggatgttccccagctcttctctgggagtctagaacatcctcctacctttctccgcggttagtttttgattccaggttttcgaacactacatcttttttatgttcttccttgtttcaaagcacttattggctgtgtttttgtagttacctattttcacactgtgagcttcccgagaatggggcctgggtttga
Sequence Length
1173
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
33,652 Da
NCBI Official Full Name
Homo sapiens cDNA clone IMAGE:3445657, containing frame-shift errors
NCBI Official Synonym Full Names
tRNA splicing endonuclease subunit 34
NCBI Official Symbol
TSEN34
NCBI Official Synonym Symbols
LENG5; PCH2C; SEN34; SEN34L
NCBI Protein Information
tRNA-splicing endonuclease subunit Sen34
UniProt Protein Name
tRNA-splicing endonuclease subunit Sen34
UniProt Gene Name
TSEN34
UniProt Synonym Gene Names
LENG5; SEN34; HsSen34
UniProt Entry Name
SEN34_HUMAN

NCBI Description

This gene encodes a catalytic subunit of the tRNA splicing endonuclease, which catalyzes the removal of introns from precursor tRNAs. The endonuclease complex is also associated with a pre-mRNA 3-prime end processing factor. A mutation in this gene results in the neurological disorder pontocerebellar hypoplasia type 2. Multiple alternatively spliced variants, encoding the same protein, have been identified.[provided by RefSeq, Oct 2009]

Uniprot Description

TSEN34: Constitutes one of the two catalytic subunit of the tRNA-splicing endonuclease complex, a complex responsible for identification and cleavage of the splice sites in pre-tRNA. It cleaves pre-tRNA at the 5'- and 3'-splice sites to release the intron. The products are an intron and two tRNA half-molecules bearing 2',3'-cyclic phosphate and 5'-OH termini. There are no conserved sequences at the splice sites, but the intron is invariably located at the same site in the gene, placing the splice sites an invariant distance from the constant structural features of the tRNA body. It probably carries the active site for 3'-splice site cleavage. The tRNA splicing endonuclease is also involved in mRNA processing via its association with pre-mRNA 3'- end processing factors, establishing a link between pre-tRNA splicing and pre-mRNA 3'-end formation, suggesting that the endonuclease subunits function in multiple RNA-processing events. Defects in TSEN34 are the cause of pontocerebellar hypoplasia type 2C (PCH2C). Pontocerebellar hypoplasia (PCH) is a heterogeneous group of disorders characterized by an abnormally small cerebellum and brainstem. PCH type 2 is characterized by progressive microcephaly from birth combined with extrapyramidal dyskinesia and chorea, epilepsy, and normal spinal cord findings. Belongs to the tRNA-intron endonuclease family.

Protein type: EC 4.6.1.16; Nucleolus; Ribonuclease

Chromosomal Location of Human Ortholog: 19q13.4

Cellular Component: nucleoplasm; nucleus

Molecular Function: tRNA-intron endonuclease activity

Biological Process: tRNA splicing; tRNA-type intron splice site recognition and cleavage

Disease: Pontocerebellar Hypoplasia, Type 2c

Similar Products

Product Notes

The TSEN34 tsen34 (Catalog #AAA1277728) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgctggtgg tggaggtggc gaacggccgc tccctggtgt ggggagccga ggcggtgcag gccctccggg agcgcctggg tgtggggggc cgcacggtag gcgccctgcc ccgcgggccc cgccagaact cgcgcctggg cctcccgctg ctgctgatgc ccgaagaggc gcggctcttg gccgagatcg gcgccgtgac tctggtcagc gccccgcgtc cagactctcg gcaccacagc ctggccctga catccttcaa gcgccagcaa gaggagagct tccaggagca gagcgccttg gcagctgagg cccgggagac ccgtcgtcag gaggtcctgg agaagattac ggagggccag gctgctaaga agcagaaact agaacaggct tcaggggcca gctcaagcca ggaggccggc tcgagccagg ctgccaaaga ggatgagacc agtgatggcc aggcttcggg agagcaggag gaagctggcc cctcgtcttc ccaagcagga ccctcaaatg gggtagcccc cttgcccaga tctgctctcc ttgtccagct ggccactgcc aggcctcgac cggtcaaggc caggcccctg gactggcgtg tccagtctaa agactggccc cacgccggcc gccctgccca cgagctgcgc tacagtatct acagagacct gtgggagcga ggcttcttcc tcagtgcggc tggcaagttc ggaggtgact tcctggtcta tcctggtgac cccctccgct tccacgccca ttatatcgct cagtgctggg cccctgagga cacctcccac tccaagacct ggttgctgct gggcgccttg gaaccagcgt cagaaagacc ctgctcctct gttctccgca gcctgatggt aaggtggtct acacctccct gcaatgggcc agcctgcagt gaactccaga gacctagggg atgtggctgt gtcggcagca agagcctttc tggatgttcc ccagctcttc tctgggagtc tagaacatcc tcctaccttt ctccgcggtt agtttttgat tccaggtttt cgaacactac atctttttta tgttcttcct tgtttcaaag cacttattgg ctgtgttttt gtagttacct attttcacac tgtgagcttc ccgagaatgg ggcctgggtt tga. It is sometimes possible for the material contained within the vial of "TSEN34, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.