Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

HK1 cdna clone

HK1 cDNA Clone

Gene Names
HK1; HK; HKD; HKI; HXK1; HMSNR; HK1-ta; HK1-tb; HK1-tc; hexokinase
Synonyms
HK1; HK1 cDNA Clone; HK1 cdna clone
Ordering
For Research Use Only!
Sequence
atgatcgccgcgcagctcctggcctattacttcacggagctgaaggatgaccaggtcaaaaagattgacaagtatctgtatgccatgcggctctccgatgaaactctcatagatatcatgactcgcttcaggaaggagatgaagaatggcctctcccgggattttaatccaacagccacagtcaagatgttgccaacattcgtaaggtccattcctgatggctctgaaaagggagatttcattgccctggatcttggtgggtcttcctttcgaattctgcgggtgcaagtgaatcatgagaaaaaccagaatgttcacatggagtccgaggtttatgacaccccagagaacatcgtgcacggcagtggaagccagctttttgatcatgttgctgagtgcctgggagatttcatggagaaaaggaagatcaaggacaagaagttacctgtgggattcacgttttcttttccttgccaacaatccaaaatagatgaggccatcctgatcacctggacaaagcgatttaaagcgagcggagtggaaggagcagatgtggtcaaactgcttaacaaagccatcaaaaagcgaggggactatgatgccaacatcgtagctgtggtgaatgacacagtgggcaccatgatgacctgtggctatgacgaccagcactgtgaagtcggcctgatcatcggcactggcaccaatgcttgctacatggaggaactgaggcacattgatctggtggaaggagacgaggggaggatgtgtatcaatacagaatggggagcctttggagacgatggatcattagaagacatccggacagagtttgacagggagatagaccggggatccctcaaccctggaaaacagctgtttgagaagatggtcagtggcatgtacttgggagagctggttcgactgatcctagtcaagatggccaaggagggcctcttatttgaagggcggatcaccccggagctgctcacccgagggaagtttaacaccagtgatgtgtcagccatcgaaaagaataaggaaggcctccacaatgccaaagaaatcctgacccgcctgggagtggagccgtccgatgatgactgtgtctcagtccagcacgtttgcaccattgtctcatttcgctcagccaacttggtggctgccacactgggcgccatcttgaaccgcctgcgtgataacaagggcacacccaggctgcggaccacggttggtgtcgacggatctctttacaagacgcacccacagtattcccggcgtttccacaagactctaaggcgcttggtgccagactccgatgtgcgcttcctcctctcggagagtggcagcggcaagggggctgccatggtgacggcggtggcctaccgcttggccgagcagcaccggcagatagaggagaccctggctcatttccacctcaccaaagacatgctgctggaggtgaagaagaggatgcgggccgagatggagctggggctgaggaagcagacgcacaacaatgccgtggttaagatgctgccctccttcgtccggagaactcccgacgggaccgagaatggtgacttcttggccctggatcttggaggaaccaatttccgtgtgctgctggtgaaaatccgtagtgggaaaaagagaacggtggaaatgcacaacaagatctacgccattcctattgaaatcatgcagggcactggggaagagctgtttgatcacattgtctcctgcatctctgacttcttggactacatggggatcaaaggccccaggatgcctctgggcttcacgttctcatttccctgccagcagacgagtctggacgcgggaatcttgatcacgtggacaaagggttttaaggcaacagactgcgtgggccacgatgtagtcaccttactaagggatgcgataaaaaggagagaggaatttgacctggacgtggtggctgtggtcaacgacacagtgggcaccatgatgacctgtgcttatgaggagcccacctgtgaggttggactcattgttgggaccggcagcaatgcctgctacatggaggagatgaagaacgtggagatggtggagggggaccaggggcagatgtgcatcaacatggagtggggggcctttggggacaacgggtgtctggatgatatcaggacacactacgacagactggtggacgaatattccctaaatgctgggaaacaaaggtatgagaagatgatcagtggtatgtacctgggtgaaatcgtccgcaacatcttaatcgacttcaccaagaagggattcctcttccgagggcagatctctgagacgctgaagacccggggcatctttgagaccaagtttctctctcagatcgagagtgaccgattagcactgctccaggtccgggctatcctccagcagctaggtctgaatagcacctgcgatgacagtatcctcgtcaagacagtgtgcggggtggtgtccaggagggccgcacagctgtgtggcgcaggcatggctgcggttgtggataagatccgcgagaacagaggactggaccgtctgaatgtgactgtgggagtggacgggacactctacaagcttcatccacacttctccagaatcatgcaccagacggtgaaggaactgtcaccaaaatgtaacgtgtccttcctcctgtctgaggatggcagcggcaagggggccgccctcatcacggccgtgggcgtgcggttacgcacagaggcaagcagctaa
Sequence Length
2754
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
101,085 Da
NCBI Official Full Name
Homo sapiens hexokinase 1, mRNA
NCBI Official Synonym Full Names
hexokinase 1
NCBI Official Symbol
HK1
NCBI Official Synonym Symbols
HK; HKD; HKI; HXK1; HMSNR; HK1-ta; HK1-tb; HK1-tc; hexokinase
NCBI Protein Information
hexokinase-1
UniProt Protein Name
Hexokinase-1
Protein Family
UniProt Gene Name
HK1
UniProt Synonym Gene Names
HK I
UniProt Entry Name
HXK1_HUMAN

NCBI Description

Hexokinases phosphorylate glucose to produce glucose-6-phosphate, the first step in most glucose metabolism pathways. This gene encodes a ubiquitous form of hexokinase which localizes to the outer membrane of mitochondria. Mutations in this gene have been associated with hemolytic anemia due to hexokinase deficiency. Alternative splicing of this gene results in several transcript variants which encode different isoforms, some of which are tissue-specific. [provided by RefSeq, Apr 2016]

Uniprot Description

HK1: a glycolytic enzyme that catalyzes the reaction ATP + D-hexose = ADP + D-hexose 6-phosphate. The first and rate-limiting step in glycosis, a pathway that produces energy in the form of ATP from glucose. An allosteric enzyme inhibited by its product glucose-6-phosphate (Glc-6-P). HK-2 and its mitochondrial receptor (VDAC) play the most pivotal and direct roles in the ""Warburg effect"". Acts as a ""glucose sensor"" by trapping glucose inside the cell by catalyzing its phosphorylation to produce Glc-6-P. In vertebrates there are four major glucose-phosphorylating isoenzymes, designated hexokinase I, II, III and IV (glucokinase). Four human isoforms are produced by alternative splicing and alternative initiation. Isoform HK1 is markedly elevated in rapidly growing tumor cells exhibiting high glucose catabolic rates. HK1 is present in most tissues but is especially prominent in brain and kidney. Isoform HK1-SC is is an integral membrane protein detected in round spermatids, condensing spermatids and mature sperm where it is found in the head membranes, mitochondria of the midpiece and the fibrous sheath of the flagellum. Isoform HK1-SA is first expressed during meiosis and continues to be present in postmeiotic germ cells while isoform HK1-SB is present only in postmeiotic germ cells.

Protein type: Carbohydrate Metabolism - amino sugar and nucleotide sugar; Carbohydrate Metabolism - fructose and mannose; Carbohydrate Metabolism - galactose; Carbohydrate Metabolism - glycolysis and gluconeogenesis; Carbohydrate Metabolism - starch and sucrose; EC 2.7.1.1; Kinase, other; Mitochondrial

Chromosomal Location of Human Ortholog: 10q22

Cellular Component: cytosol; mitochondrion

Molecular Function: fructokinase activity; glucokinase activity; hexokinase activity; mannokinase activity; protein binding

Biological Process: cell glucose homeostasis; glucose transport; glycolysis

Disease: Hemolytic Anemia, Nonspherocytic, Due To Hexokinase Deficiency; Neuropathy, Hereditary Motor And Sensory, Russe Type

Research Articles on HK1

Similar Products

Product Notes

The HK1 hk1 (Catalog #AAA1277711) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgatcgccg cgcagctcct ggcctattac ttcacggagc tgaaggatga ccaggtcaaa aagattgaca agtatctgta tgccatgcgg ctctccgatg aaactctcat agatatcatg actcgcttca ggaaggagat gaagaatggc ctctcccggg attttaatcc aacagccaca gtcaagatgt tgccaacatt cgtaaggtcc attcctgatg gctctgaaaa gggagatttc attgccctgg atcttggtgg gtcttccttt cgaattctgc gggtgcaagt gaatcatgag aaaaaccaga atgttcacat ggagtccgag gtttatgaca ccccagagaa catcgtgcac ggcagtggaa gccagctttt tgatcatgtt gctgagtgcc tgggagattt catggagaaa aggaagatca aggacaagaa gttacctgtg ggattcacgt tttcttttcc ttgccaacaa tccaaaatag atgaggccat cctgatcacc tggacaaagc gatttaaagc gagcggagtg gaaggagcag atgtggtcaa actgcttaac aaagccatca aaaagcgagg ggactatgat gccaacatcg tagctgtggt gaatgacaca gtgggcacca tgatgacctg tggctatgac gaccagcact gtgaagtcgg cctgatcatc ggcactggca ccaatgcttg ctacatggag gaactgaggc acattgatct ggtggaagga gacgagggga ggatgtgtat caatacagaa tggggagcct ttggagacga tggatcatta gaagacatcc ggacagagtt tgacagggag atagaccggg gatccctcaa ccctggaaaa cagctgtttg agaagatggt cagtggcatg tacttgggag agctggttcg actgatccta gtcaagatgg ccaaggaggg cctcttattt gaagggcgga tcaccccgga gctgctcacc cgagggaagt ttaacaccag tgatgtgtca gccatcgaaa agaataagga aggcctccac aatgccaaag aaatcctgac ccgcctggga gtggagccgt ccgatgatga ctgtgtctca gtccagcacg tttgcaccat tgtctcattt cgctcagcca acttggtggc tgccacactg ggcgccatct tgaaccgcct gcgtgataac aagggcacac ccaggctgcg gaccacggtt ggtgtcgacg gatctcttta caagacgcac ccacagtatt cccggcgttt ccacaagact ctaaggcgct tggtgccaga ctccgatgtg cgcttcctcc tctcggagag tggcagcggc aagggggctg ccatggtgac ggcggtggcc taccgcttgg ccgagcagca ccggcagata gaggagaccc tggctcattt ccacctcacc aaagacatgc tgctggaggt gaagaagagg atgcgggccg agatggagct ggggctgagg aagcagacgc acaacaatgc cgtggttaag atgctgccct ccttcgtccg gagaactccc gacgggaccg agaatggtga cttcttggcc ctggatcttg gaggaaccaa tttccgtgtg ctgctggtga aaatccgtag tgggaaaaag agaacggtgg aaatgcacaa caagatctac gccattccta ttgaaatcat gcagggcact ggggaagagc tgtttgatca cattgtctcc tgcatctctg acttcttgga ctacatgggg atcaaaggcc ccaggatgcc tctgggcttc acgttctcat ttccctgcca gcagacgagt ctggacgcgg gaatcttgat cacgtggaca aagggtttta aggcaacaga ctgcgtgggc cacgatgtag tcaccttact aagggatgcg ataaaaagga gagaggaatt tgacctggac gtggtggctg tggtcaacga cacagtgggc accatgatga cctgtgctta tgaggagccc acctgtgagg ttggactcat tgttgggacc ggcagcaatg cctgctacat ggaggagatg aagaacgtgg agatggtgga gggggaccag gggcagatgt gcatcaacat ggagtggggg gcctttgggg acaacgggtg tctggatgat atcaggacac actacgacag actggtggac gaatattccc taaatgctgg gaaacaaagg tatgagaaga tgatcagtgg tatgtacctg ggtgaaatcg tccgcaacat cttaatcgac ttcaccaaga agggattcct cttccgaggg cagatctctg agacgctgaa gacccggggc atctttgaga ccaagtttct ctctcagatc gagagtgacc gattagcact gctccaggtc cgggctatcc tccagcagct aggtctgaat agcacctgcg atgacagtat cctcgtcaag acagtgtgcg gggtggtgtc caggagggcc gcacagctgt gtggcgcagg catggctgcg gttgtggata agatccgcga gaacagagga ctggaccgtc tgaatgtgac tgtgggagtg gacgggacac tctacaagct tcatccacac ttctccagaa tcatgcacca gacggtgaag gaactgtcac caaaatgtaa cgtgtccttc ctcctgtctg aggatggcag cggcaagggg gccgccctca tcacggccgt gggcgtgcgg ttacgcacag aggcaagcag ctaa. It is sometimes possible for the material contained within the vial of "HK1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.