Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

APOH cdna clone

APOH cDNA Clone

Gene Names
APOH; BG; B2G1; B2GP1
Synonyms
APOH; APOH cDNA Clone; APOH cdna clone
Ordering
For Research Use Only!
Sequence
atgatttctccagtgctcatcttgttctcgagttttctctgccatgttgctattgcaggacggacctgtcccaagccagatgatttaccattttccacagtggtcccgttaaaaacattctatgagccaggagaagagattacgtattcctgcaagccgggctatgtgtcccgaggagggatgagaaagtttatctgccctctcacaggactgtggcccatcaacactctgaaatgtacacccagagtatgtccttttgctggaatcttagaaaatggagccgtacgctatacgacttttgaatatcccaacacgatcagtttttcttgtaacactgggttttatctgaatggcgctgattctgccaagtgcactgaggaaggaaaatggagcccggagcttcctgtctgtgctcccatcatctgccctccaccatccatacctacgtttgcaacacttcgtgtttataagccatcagctggaaacaattccctctatcgggacacagcagtttttgaatgtttgccacaacatgcgatgtttggaaatgatacaattacctgcacgacacatggaaattggactaaattaccagaatgcagggaagtaaaatgcccattcccatcaagaccagacaatggatttgtgaactatcctgcaaaaccaacactttattacaaggataaagccacatttggctgccatgatggatattctctggatggcccggaagaaatagaatgtaccaaactgggaaactggtctgccatgccaagttgtaaagcatcttgtaaagtacctgtgaaaaaagccactgtggtgtaccaaggagagagagtaaagattcaggaaaaatttaagaatggaatgctacatggtgataaagtttctttcttctgcaaaaataaggaaaagaagtgtagctatacagaggatgctcagtgtatagatggcactatcgaagtccccaaatgcttcaaggaacacagttctctggctttttggaaaactgatgcatccgatgtaaagccatgctaa
Sequence Length
1038
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
350
Molecular Weight
38,298 Da
NCBI Official Full Name
Homo sapiens apolipoprotein H (beta-2-glycoprotein I), mRNA
NCBI Official Synonym Full Names
apolipoprotein H
NCBI Official Symbol
APOH
NCBI Official Synonym Symbols
BG; B2G1; B2GP1
NCBI Protein Information
beta-2-glycoprotein 1
UniProt Protein Name
Beta-2-glycoprotein 1
Protein Family
UniProt Gene Name
APOH
UniProt Synonym Gene Names
B2G1; Apo-H; B2GPI; Beta(2)GPI
UniProt Entry Name
APOH_HUMAN

NCBI Description

Apolipoprotein H has been implicated in a variety of physiologic pathways including lipoprotein metabolism, coagulation, and the production of antiphospholipid autoantibodies. APOH may be a required cofactor for anionic phospholipid binding by the antiphospholipid autoantibodies found in sera of many patients with lupus and primary antiphospholipid syndrome, but it does not seem to be required for the reactivity of antiphospholipid autoantibodies associated with infections. [provided by RefSeq, Jul 2008]

Uniprot Description

APOH: Binds to various kinds of negatively charged substances such as heparin, phospholipids, and dextran sulfate. May prevent activation of the intrinsic blood coagulation cascade by binding to phospholipids on the surface of damaged cells.

Protein type: Lipid-binding; Secreted; Secreted, signal peptide

Chromosomal Location of Human Ortholog: 17q24.2

Cellular Component: cell surface; chylomicron; extracellular matrix; extracellular region; extracellular space

Molecular Function: glycoprotein binding; identical protein binding; lipid binding; phospholipid binding; protein binding

Biological Process: blood coagulation, intrinsic pathway; negative regulation of angiogenesis; negative regulation of blood coagulation; negative regulation of endothelial cell proliferation; negative regulation of fibrinolysis; negative regulation of myeloid cell apoptosis; plasminogen activation; platelet degranulation; positive regulation of blood coagulation; positive regulation of lipoprotein lipase activity; regulation of fibrinolysis; triacylglycerol metabolic process; triacylglycerol transport

Research Articles on APOH

Similar Products

Product Notes

The APOH apoh (Catalog #AAA1277658) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgatttctc cagtgctcat cttgttctcg agttttctct gccatgttgc tattgcagga cggacctgtc ccaagccaga tgatttacca ttttccacag tggtcccgtt aaaaacattc tatgagccag gagaagagat tacgtattcc tgcaagccgg gctatgtgtc ccgaggaggg atgagaaagt ttatctgccc tctcacagga ctgtggccca tcaacactct gaaatgtaca cccagagtat gtccttttgc tggaatctta gaaaatggag ccgtacgcta tacgactttt gaatatccca acacgatcag tttttcttgt aacactgggt tttatctgaa tggcgctgat tctgccaagt gcactgagga aggaaaatgg agcccggagc ttcctgtctg tgctcccatc atctgccctc caccatccat acctacgttt gcaacacttc gtgtttataa gccatcagct ggaaacaatt ccctctatcg ggacacagca gtttttgaat gtttgccaca acatgcgatg tttggaaatg atacaattac ctgcacgaca catggaaatt ggactaaatt accagaatgc agggaagtaa aatgcccatt cccatcaaga ccagacaatg gatttgtgaa ctatcctgca aaaccaacac tttattacaa ggataaagcc acatttggct gccatgatgg atattctctg gatggcccgg aagaaataga atgtaccaaa ctgggaaact ggtctgccat gccaagttgt aaagcatctt gtaaagtacc tgtgaaaaaa gccactgtgg tgtaccaagg agagagagta aagattcagg aaaaatttaa gaatggaatg ctacatggtg ataaagtttc tttcttctgc aaaaataagg aaaagaagtg tagctataca gaggatgctc agtgtataga tggcactatc gaagtcccca aatgcttcaa ggaacacagt tctctggctt tttggaaaac tgatgcatcc gatgtaaagc catgctaa. It is sometimes possible for the material contained within the vial of "APOH, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.