Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PRDX3 cdna clone

PRDX3 cDNA Clone

Gene Names
PRDX3; AOP1; MER5; AOP-1; SP-22; HBC189; PRO1748; prx-III
Synonyms
PRDX3; PRDX3 cDNA Clone; PRDX3 cdna clone
Ordering
For Research Use Only!
Sequence
atggcggctgctgtaggacggttgctccgagcgtcggttgcccgacatgtgagtgccattccttggggcatttctgccactgcagccctctggcctgctgcatgtggaagaacgagcttgacaaatttattgtgttctggttccagtcaagcaaaattattcagcaccagttcctcatgccatgcacctgctgtcacccagcatgcaccctattttaagggtacagccgttgtcaatggagagttcaaagacctaagccttgatgactttaaggggaaatatttggtgcttttcttctatcctttggatttcacctttgtgtgtcctacagaaattgttgcttttagtgacaaagctaacgaatttcacgatgtgaactgtgaagttgtcgcagtctcagtggattcccactttagccatcttgcctggataaatacaccaagaaagaatggtggtttgggccacatgaacatcgcactcttgtcagacttaactaagcagatttcccgagactacggtgtgctgttagaaggttctggtcttgcactaagaggtctcttcataattgaccccaatggagtcatcaagcatttgagcgtcaacgatctcccagtgggccgaagcgtggaagaaaccctccgcttggtgaaggcgttccagtatgtagaaacacatggagaagtctgcccagcgaactggacaccggattctcctacgatcaagccaagtccagctgcttccaaagagtactttcagaaggtaaatcagtag
Sequence Length
771
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
25,839 Da
NCBI Official Full Name
Homo sapiens peroxiredoxin 3, mRNA
NCBI Official Synonym Full Names
peroxiredoxin 3
NCBI Official Symbol
PRDX3
NCBI Official Synonym Symbols
AOP1; MER5; AOP-1; SP-22; HBC189; PRO1748; prx-III
NCBI Protein Information
thioredoxin-dependent peroxide reductase, mitochondrial
UniProt Protein Name
Thioredoxin-dependent peroxide reductase, mitochondrial
UniProt Gene Name
PRDX3
UniProt Synonym Gene Names
AOP1; AOP-1; Prx-III
UniProt Entry Name
PRDX3_HUMAN

NCBI Description

This gene encodes a mitochondrial protein with antioxidant function. The protein is similar to the C22 subunit of Salmonella typhimurium alkylhydroperoxide reductase, and it can rescue bacterial resistance to alkylhydroperoxide in E. coli that lack the C22 subunit. The human and mouse genes are highly conserved, and they map to the regions syntenic between mouse and human chromosomes. Sequence comparisons with recently cloned mammalian homologs suggest that these genes consist of a family that is responsible for the regulation of cellular proliferation, differentiation and antioxidant functions. This family member can protect cells from oxidative stress, and it can promote cell survival in prostate cancer. Alternative splicing of this gene results in multiple transcript variants. Related pseudogenes have been identified on chromosomes 1, 3, 13 and 22. [provided by RefSeq, Oct 2014]

Uniprot Description

PRDX3: Involved in redox regulation of the cell. Protects radical-sensitive enzymes from oxidative damage by a radical- generating system. Acts synergistically with MAP3K13 to regulate the activation of NF-kappa-B in the cytosol. Belongs to the AhpC/TSA family.

Protein type: EC 1.11.1.15; Apoptosis; Mitochondrial; Oxidoreductase

Chromosomal Location of Human Ortholog: 10q25-q26

Cellular Component: cytoplasm; cytosol; early endosome; IkappaB kinase complex; mitochondrial matrix; mitochondrion

Molecular Function: caspase inhibitor activity; kinase binding; protein binding; protein C-terminus binding; protein kinase binding; thioredoxin peroxidase activity

Biological Process: activation of NF-kappaB transcription factor; hydrogen peroxide catabolic process; mitochondrion organization and biogenesis; myeloid cell differentiation; negative regulation of apoptosis; negative regulation of kinase activity; peptidyl-cysteine oxidation; positive regulation of cell proliferation; regulation of mitochondrial membrane potential; response to hydrogen peroxide; response to lipopolysaccharide; response to oxidative stress; response to reactive oxygen species

Research Articles on PRDX3

Similar Products

Product Notes

The PRDX3 prdx3 (Catalog #AAA1277612) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcggctg ctgtaggacg gttgctccga gcgtcggttg cccgacatgt gagtgccatt ccttggggca tttctgccac tgcagccctc tggcctgctg catgtggaag aacgagcttg acaaatttat tgtgttctgg ttccagtcaa gcaaaattat tcagcaccag ttcctcatgc catgcacctg ctgtcaccca gcatgcaccc tattttaagg gtacagccgt tgtcaatgga gagttcaaag acctaagcct tgatgacttt aaggggaaat atttggtgct tttcttctat cctttggatt tcacctttgt gtgtcctaca gaaattgttg cttttagtga caaagctaac gaatttcacg atgtgaactg tgaagttgtc gcagtctcag tggattccca ctttagccat cttgcctgga taaatacacc aagaaagaat ggtggtttgg gccacatgaa catcgcactc ttgtcagact taactaagca gatttcccga gactacggtg tgctgttaga aggttctggt cttgcactaa gaggtctctt cataattgac cccaatggag tcatcaagca tttgagcgtc aacgatctcc cagtgggccg aagcgtggaa gaaaccctcc gcttggtgaa ggcgttccag tatgtagaaa cacatggaga agtctgccca gcgaactgga caccggattc tcctacgatc aagccaagtc cagctgcttc caaagagtac tttcagaagg taaatcagta g. It is sometimes possible for the material contained within the vial of "PRDX3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.