FMO2 cdna clone
FMO2 cDNA Clone
Gene Names
FMO2; FMO1B1
Synonyms
FMO2; FMO2 cDNA Clone; FMO2 cdna clone
Sequence
atggcaaagaaggtagctgtgattggagctggggtcagtggcctaatttctctgaagtgctgtgtggatgagggacttgagcccacttgctttgagagaactgaagatattggaggagtgtggaggttcaaagagaatgtggaagatggccgagcaagtatctatcaatctgtcgttaccaacaccagcaaagaaatgtcctgtttcagtgactttccaatgcctgaagattttccaaacttcctgcataattctaaacttctggaatatttcaggatttttgctaaaaaatttgatctgctaaaatatattcagttccagacaactgtccttagtgtgagaaaatgtccagatttctcatcctctggccaatggaaggttgtcactcagagcaacggcaaggagcagagtgctgtctttgacgcagttatggtttgcagtggccaccacattctacctcatatcccactgaagtcatttccaggtatggagaggttcaaaggccaatatttccatagccgccaatacaagcatccagatggatttgagggaaaacgcatcctggtgattggaatgggaaactcaggctcagatattgctgttgagctgagtaagaatgctgctcaggtttttatcagcaccaggcatggcacctgggtcatgagccgtatctctgaagatggctatccttgggactcagtgttccacacccggtttcgttctatgctccgcaatgtactgccacgaacagctgtaaaatggatgatagaacaacagatgaatcggtggttcaaccatgaaaattatggccttgagcctcaaaacaaatacattatgaaggaacctgtactaaatgatgatgtcccaagtcgtctactctgtggagccatcaaggtgaaatctacagtgaaagagctcacagaaacttctgccatctttgaggatggaacagtggaggagaacattgatgtcatcatttttgcaacaggatatagtttctcttttcccttccttgaagattcactcgttaaagtagagaataatatggtctcactgtataaatacatattccccgctcacctggacaagtcaaccctcgcgtgcattggtctcatccagcccctaggttccattttcccaactgctgaacttcaagctcgttgggtgacaagagttttcaaaggcttgtgtagcctgccctcagagagaactatgatgatggacattatcaaaaggaatgaaaaaagaattgacctgtttggagaaagccagagccagacgttgcagaccaattatgttgactacttggacgagctcgccttagagataggtgcgaagccagatttctgctctctcttgttcaaagatcctaaactggctgtgagactctatttcggaccctgcaactcctattag
Sequence Length
1416
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
53,644 Da
NCBI Official Full Name
Homo sapiens flavin containing monooxygenase 2 (non-functional), mRNA
NCBI Official Synonym Full Names
flavin containing monooxygenase 2
NCBI Official Symbol
FMO2
NCBI Official Synonym Symbols
FMO1B1
NCBI Protein Information
dimethylaniline monooxygenase [N-oxide-forming] 2
UniProt Protein Name
Dimethylaniline monooxygenase [N-oxide-forming] 2
Protein Family
UniProt Gene Name
FMO2
UniProt Synonym Gene Names
FMO 2
UniProt Entry Name
FMO2_HUMAN
NCBI Description
This gene encodes a flavin-containing monooxygenase family member. It is an NADPH-dependent enzyme that catalyzes the N-oxidation of some primary alkylamines through an N-hydroxylamine intermediate. However, some human populations contain an allele (FMO2*2A) with a premature stop codon, resulting in a protein that is C-terminally-truncated, has no catalytic activity, and is likely degraded rapidly. This gene is found in a cluster with other related family members on chromosome 1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2014]
Uniprot Description
Catalyzes the N-oxidation of certain primary alkylamines to their oximes via an N-hydroxylamine intermediate. Inactive toward certain tertiary amines, such as imipramine or chloropromazine. Can catalyze the S-oxidation of methimazole. The truncated form is catalytically inactive.
Research Articles on FMO2
Similar Products
Product Notes
The FMO2 fmo2 (Catalog #AAA1277585) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcaaaga aggtagctgt gattggagct ggggtcagtg gcctaatttc tctgaagtgc tgtgtggatg agggacttga gcccacttgc tttgagagaa ctgaagatat tggaggagtg tggaggttca aagagaatgt ggaagatggc cgagcaagta tctatcaatc tgtcgttacc aacaccagca aagaaatgtc ctgtttcagt gactttccaa tgcctgaaga ttttccaaac ttcctgcata attctaaact tctggaatat ttcaggattt ttgctaaaaa atttgatctg ctaaaatata ttcagttcca gacaactgtc cttagtgtga gaaaatgtcc agatttctca tcctctggcc aatggaaggt tgtcactcag agcaacggca aggagcagag tgctgtcttt gacgcagtta tggtttgcag tggccaccac attctacctc atatcccact gaagtcattt ccaggtatgg agaggttcaa aggccaatat ttccatagcc gccaatacaa gcatccagat ggatttgagg gaaaacgcat cctggtgatt ggaatgggaa actcaggctc agatattgct gttgagctga gtaagaatgc tgctcaggtt tttatcagca ccaggcatgg cacctgggtc atgagccgta tctctgaaga tggctatcct tgggactcag tgttccacac ccggtttcgt tctatgctcc gcaatgtact gccacgaaca gctgtaaaat ggatgataga acaacagatg aatcggtggt tcaaccatga aaattatggc cttgagcctc aaaacaaata cattatgaag gaacctgtac taaatgatga tgtcccaagt cgtctactct gtggagccat caaggtgaaa tctacagtga aagagctcac agaaacttct gccatctttg aggatggaac agtggaggag aacattgatg tcatcatttt tgcaacagga tatagtttct cttttccctt ccttgaagat tcactcgtta aagtagagaa taatatggtc tcactgtata aatacatatt ccccgctcac ctggacaagt caaccctcgc gtgcattggt ctcatccagc ccctaggttc cattttccca actgctgaac ttcaagctcg ttgggtgaca agagttttca aaggcttgtg tagcctgccc tcagagagaa ctatgatgat ggacattatc aaaaggaatg aaaaaagaat tgacctgttt ggagaaagcc agagccagac gttgcagacc aattatgttg actacttgga cgagctcgcc ttagagatag gtgcgaagcc agatttctgc tctctcttgt tcaaagatcc taaactggct gtgagactct atttcggacc ctgcaactcc tattag. It is sometimes possible for the material contained within the vial of "FMO2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
