Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

MPG cdna clone

MPG cDNA Clone

Gene Names
MPG; AAG; MDG; ADPG; APNG; Mid1; anpg; PIG11; PIG16; CRA36.1
Synonyms
MPG; MPG cDNA Clone; MPG cdna clone
Ordering
For Research Use Only!
Sequence
atgcccgcgcgcagcggggcccagttttgccgacggatggggcaaaagaagcagcgaccagctagagcagggcagccacacagctcgtccgacgcagcccaggcacctgcagagcagccacacagctcgtccgatgcagcccaggcaccttgccccagggagcgctgcttgggaccgcccaccactccgggcccataccgcagcatctatttctcaagcccaaagggccaccttacccgactggggttggagttcttcgaccagccggcagtccccctggcccgggcatttctgggacaggtcctagtccggcgacttcctaatggcacagaactccgaggccgcatcgtggagaccgaggcatacctggggccagaggatgaagccgcccactcaaggggtggccggcagaccccccgcaaccgaggcatgttcatgaagccggggaccctgtacgtgtacatcatttacggcatgtacttctgcatgaacatctccagccagggggacggggcttgcgtcttgctgcgagcactggagcccctggaaggtctggagaccatgcgtcagcttcgcagcaccctccggaaaggcaccgccagccgtgtcctcaaggaccgcgagctctgcagtggcccctccaagctgtgccaggccctggccatcaacaagagctttgaccagagggacctggcacaggatgaagctgtatggctggagcgtggtcccctggagcccagtgagccggctgtagtggcagcagcccgggtgggcgtcggccatgcaggggagtgggcccggaaacccctccgcttctatgtccggggcagcccctgggtcagtgtggtcgacagagtggctgagcaggacacacaggcctga
Sequence Length
882
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
30,824 Da
NCBI Official Full Name
Homo sapiens N-methylpurine-DNA glycosylase, mRNA
NCBI Official Synonym Full Names
N-methylpurine DNA glycosylase
NCBI Official Symbol
MPG
NCBI Official Synonym Symbols
AAG; MDG; ADPG; APNG; Mid1; anpg; PIG11; PIG16; CRA36.1
NCBI Protein Information
DNA-3-methyladenine glycosylase
UniProt Protein Name
DNA-3-methyladenine glycosylase
UniProt Gene Name
MPG
UniProt Synonym Gene Names
AAG; ANPG; MID1
UniProt Entry Name
3MG_HUMAN

Uniprot Description

MPG: Hydrolysis of the deoxyribose N-glycosidic bond to excise 3-methyladenine, and 7-methylguanine from the damaged DNA polymer formed by alkylation lesions. Belongs to the DNA glycosylase MPG family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: EC 3.2.2.21; Hydrolase; Nuclear receptor co-regulator

Chromosomal Location of Human Ortholog: 16p13.3

Cellular Component: nucleoplasm

Molecular Function: alkylbase DNA N-glycosylase activity; damaged DNA binding; DNA N-glycosylase activity; protein binding

Biological Process: base-excision repair; depurination; DNA dealkylation

Research Articles on MPG

Similar Products

Product Notes

The MPG mpg (Catalog #AAA1277564) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcccgcgc gcagcggggc ccagttttgc cgacggatgg ggcaaaagaa gcagcgacca gctagagcag ggcagccaca cagctcgtcc gacgcagccc aggcacctgc agagcagcca cacagctcgt ccgatgcagc ccaggcacct tgccccaggg agcgctgctt gggaccgccc accactccgg gcccataccg cagcatctat ttctcaagcc caaagggcca ccttacccga ctggggttgg agttcttcga ccagccggca gtccccctgg cccgggcatt tctgggacag gtcctagtcc ggcgacttcc taatggcaca gaactccgag gccgcatcgt ggagaccgag gcatacctgg ggccagagga tgaagccgcc cactcaaggg gtggccggca gaccccccgc aaccgaggca tgttcatgaa gccggggacc ctgtacgtgt acatcattta cggcatgtac ttctgcatga acatctccag ccagggggac ggggcttgcg tcttgctgcg agcactggag cccctggaag gtctggagac catgcgtcag cttcgcagca ccctccggaa aggcaccgcc agccgtgtcc tcaaggaccg cgagctctgc agtggcccct ccaagctgtg ccaggccctg gccatcaaca agagctttga ccagagggac ctggcacagg atgaagctgt atggctggag cgtggtcccc tggagcccag tgagccggct gtagtggcag cagcccgggt gggcgtcggc catgcagggg agtgggcccg gaaacccctc cgcttctatg tccggggcag cccctgggtc agtgtggtcg acagagtggc tgagcaggac acacaggcct ga. It is sometimes possible for the material contained within the vial of "MPG, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.