Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

RNF166 cdna clone

RNF166 cDNA Clone

Synonyms
RNF166; RNF166 cDNA Clone; RNF166 cdna clone
Ordering
For Research Use Only!
Sequence
atggctatgttccgcagcctggtggcctcggctcagcagcggcagccgccggccgggccggcgggcggcgacagcggcctggaggcgcagtacacctgccccatctgcctggaggtctatcaccggcccgtggccatcggcagctgcggccacacgttctgcggggagtgtctccagccctgcctgcaggtgccatccccgctgtgcccactctgccgcctgcccttcgaccccaagaaggtggacaaggccacccacgtggagaagcagctctcatcctacaaagcgccctgtcgaggctgcaacaaaaaggtgaccctggcaaagatgagagtgcacatttcgtcctgcctgaaggtccaggagcagatggccaactgccccaagttcgtccccgtggtgcccacatcacagcctatccccagcaacatccccaacaggtccaccttcgcctgcccgtactgtggtgcccgcaacctggaccagcaggagctggtgaagcactgtgtggaaagccaccgcagcgaccccaaccgcgtggtgtgccccatctgctcggcaatgccctggggggaccccagctacaagagcgccaacttcctgcagcacctgcttcaccgacacaagttctcctacgacacctttgtggactacagtattgacgaggaggccgccttccaggctgctctggccctgtctctctctgagaactga
Sequence Length
714
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
17,187 Da
NCBI Official Full Name
Homo sapiens ring finger protein 166, mRNA
NCBI Official Synonym Full Names
ring finger protein 166
NCBI Official Symbol
RNF166
NCBI Protein Information
RING finger protein 166
UniProt Protein Name
RING finger protein 166
Protein Family
UniProt Gene Name
RNF166
UniProt Entry Name
RN166_HUMAN

Uniprot Description

RNF166: 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Ubiquitin conjugating system

Chromosomal Location of Human Ortholog: 16q24.3

Cellular Component: intracellular

Molecular Function: ubiquitin conjugating enzyme binding

Biological Process: positive regulation of proteasomal ubiquitin-dependent protein catabolic process; protein polyubiquitination

Research Articles on RNF166

Similar Products

Product Notes

The RNF166 rnf166 (Catalog #AAA1277524) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggctatgt tccgcagcct ggtggcctcg gctcagcagc ggcagccgcc ggccgggccg gcgggcggcg acagcggcct ggaggcgcag tacacctgcc ccatctgcct ggaggtctat caccggcccg tggccatcgg cagctgcggc cacacgttct gcggggagtg tctccagccc tgcctgcagg tgccatcccc gctgtgccca ctctgccgcc tgcccttcga ccccaagaag gtggacaagg ccacccacgt ggagaagcag ctctcatcct acaaagcgcc ctgtcgaggc tgcaacaaaa aggtgaccct ggcaaagatg agagtgcaca tttcgtcctg cctgaaggtc caggagcaga tggccaactg ccccaagttc gtccccgtgg tgcccacatc acagcctatc cccagcaaca tccccaacag gtccaccttc gcctgcccgt actgtggtgc ccgcaacctg gaccagcagg agctggtgaa gcactgtgtg gaaagccacc gcagcgaccc caaccgcgtg gtgtgcccca tctgctcggc aatgccctgg ggggacccca gctacaagag cgccaacttc ctgcagcacc tgcttcaccg acacaagttc tcctacgaca cctttgtgga ctacagtatt gacgaggagg ccgccttcca ggctgctctg gccctgtctc tctctgagaa ctga. It is sometimes possible for the material contained within the vial of "RNF166, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.