Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CLIC5 cdna clone

CLIC5 cDNA Clone

Gene Names
CLIC5; MST130; DFNB102; DFNB103; MSTP130
Synonyms
CLIC5; CLIC5 cDNA Clone; CLIC5 cdna clone
Ordering
For Research Use Only!
Sequence
atggccctgtcctcagcattcccttcttgtgctggtggggccagtgaagtcttgatcttatcagaaaaaggccacaccaagtgcgagttttcccaggctgactttccaggcccttatcaaatgaaacaacagaagctcttcacagttctgtgccccatggccactccacagacagacaataccaagcatcttagaactgtcataagatag
Sequence Length
210
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
22,830 Da
NCBI Official Full Name
Homo sapiens chloride intracellular channel 5, mRNA
NCBI Official Synonym Full Names
chloride intracellular channel 5
NCBI Official Symbol
CLIC5
NCBI Official Synonym Symbols
MST130; DFNB102; DFNB103; MSTP130
NCBI Protein Information
chloride intracellular channel protein 5
UniProt Protein Name
Chloride intracellular channel protein 5
UniProt Gene Name
CLIC5
UniProt Entry Name
CLIC5_HUMAN

NCBI Description

This gene encodes a member of the chloride intracellular channel (CLIC) family of chloride ion channels. The encoded protein associates with actin-based cytoskeletal structures and may play a role in multiple processes including hair cell stereocilia formation, myoblast proliferation and glomerular podocyte and endothelial cell maintenance. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]

Uniprot Description

CLIC5: Can insert into membranes and form poorly selective ion channels that may also transport chloride ions. May play a role in the regulation of transepithelial ion absorption and secretion. Required for normal formation of stereocilia in the inner ear and normal development of the organ of Corti. Is required for the development and/or maintenance of the proper glomerular endothelial cell and podocyte architecture. Belongs to the chloride channel CLIC family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Motility/polarity/chemotaxis; Membrane protein, integral

Chromosomal Location of Human Ortholog: 6p12.3

Cellular Component: actin cytoskeleton; nucleus

Molecular Function: chloride channel activity; glutathione transferase activity; protein binding

Biological Process: auditory receptor cell stereocilium organization and biogenesis; chloride transport; female pregnancy; glutathione metabolic process; sensory perception of sound

Disease: Deafness, Autosomal Recessive 103

Research Articles on CLIC5

Similar Products

Product Notes

The CLIC5 clic5 (Catalog #AAA1277495) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggccctgt cctcagcatt cccttcttgt gctggtgggg ccagtgaagt cttgatctta tcagaaaaag gccacaccaa gtgcgagttt tcccaggctg actttccagg cccttatcaa atgaaacaac agaagctctt cacagttctg tgccccatgg ccactccaca gacagacaat accaagcatc ttagaactgt cataagatag. It is sometimes possible for the material contained within the vial of "CLIC5, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.