RSL1D1 cdna clone
RSL1D1 cDNA Clone
Gene Names
RSL1D1; L12; CSIG; PBK1; UTP30
Synonyms
RSL1D1; RSL1D1 cDNA Clone; RSL1D1 cdna clone
Sequence
atggaggattcggcctcggcctcgctgtcttctgcagccgctactggaacctccacctcgactccagcggccccgacagcacggaagcagctggataaagaacaggttagaaaggcagtggacgctctcttgacgcattgcaagtccaggaaaaacaattatgggttgcttttgaatgagaatgaaagtttatttttaatggtggtattatggaaaattccaagtaaagaactgagggtcagattgaccttgcctcatagtattcgatcagattcagaagatatctgtttatttacgaaggatgaacccaattcaactcctgaaaagacagaacagttttatagaaagcttttaaacaagcatggaattaaaaccgtttctcagattatctccctccaaactctaaagaaggaatataaatcctatgaagccaagctccgccttctgagcagttttgatttcttccttactgatgccagaattaggcggctcttaccctcactcattgggagacatttctatcaaagaaagaaagttccagtatctgtaaaccttctgtccaagaatttatcaagagagatcaatgactgtataggtggaacagtcttaaacatttctaaaagtggttcttgcagtgctatacgtattggtcacgttggaatgcaaattgagcacatcattgaaaacattgttgctgtcaccaaaggactttcagaaaaattgccagagaagtgggagagcgtgaaactcctgtttgtgaaaactgagaaatcggctgcacttcccatcttttcctcgtttgtcagcaattgggatgaagccaccaaaagatctttgcttaataagaagaaaaaagaggcaaggagaaaacgaagagaaagaaattttgaaaaacaaaaggagaggaagaagaagaggcagcaggctaggaagactgcatcagttcttagtaaagatgatgtggcacctgaaagtggtgatactacagtgaagaaacctgaatcaaagaaggaacagaccccagagcatgggaagaaaaaacgtggcagaggaaaagcccaagttaaagcaacaaatgaatccgaagacgaaatcccacagctggtaccaataggaaagaagactccagctaatgaaaaagtagagattcaaaaacatgccacaggaaagaagtctccagcaaagagtcctaatcccagcacacctcgtgggaagaaaagaaaggctttgccagcatctgagaccccaaaagctgcagagtctgagaccccagggaaaagcccagagaagaagccaaaaatcaaagaagaggcagtgaaggaaaaaagtccttcgctggggaaaaaagatgcgagacagactccaaaaaagccagaggccaagtttttcaccactcctagtaaatctgtgagaaaagcttcccacacccccaaaaaatggcccaaaaaacccaaagtaccccagtcgacctaa
Sequence Length
1473
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
30,354 Da
NCBI Official Full Name
Homo sapiens ribosomal L1 domain containing 1, mRNA
NCBI Official Synonym Full Names
ribosomal L1 domain containing 1
NCBI Official Symbol
RSL1D1
NCBI Official Synonym Symbols
L12; CSIG; PBK1; UTP30
NCBI Protein Information
ribosomal L1 domain-containing protein 1
UniProt Protein Name
Ribosomal L1 domain-containing protein 1
Protein Family
UniProt Gene Name
RSL1D1
UniProt Entry Name
RL1D1_HUMAN
Uniprot Description
CSIG: Belongs to the ribosomal protein L1P family. Highly divergent.
Protein type: RNA-binding; Translation; Nucleolus
Chromosomal Location of Human Ortholog: 16p13.13
Cellular Component: cell-cell adherens junction; membrane; nucleolus
Molecular Function: RNA binding
Biological Process: maturation of LSU-rRNA; osteoblast differentiation; regulation of apoptosis; regulation of protein localization; translation
Research Articles on RSL1D1
Similar Products
Product Notes
The RSL1D1 rsl1d1 (Catalog #AAA1277468) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggaggatt cggcctcggc ctcgctgtct tctgcagccg ctactggaac ctccacctcg actccagcgg ccccgacagc acggaagcag ctggataaag aacaggttag aaaggcagtg gacgctctct tgacgcattg caagtccagg aaaaacaatt atgggttgct tttgaatgag aatgaaagtt tatttttaat ggtggtatta tggaaaattc caagtaaaga actgagggtc agattgacct tgcctcatag tattcgatca gattcagaag atatctgttt atttacgaag gatgaaccca attcaactcc tgaaaagaca gaacagtttt atagaaagct tttaaacaag catggaatta aaaccgtttc tcagattatc tccctccaaa ctctaaagaa ggaatataaa tcctatgaag ccaagctccg ccttctgagc agttttgatt tcttccttac tgatgccaga attaggcggc tcttaccctc actcattggg agacatttct atcaaagaaa gaaagttcca gtatctgtaa accttctgtc caagaattta tcaagagaga tcaatgactg tataggtgga acagtcttaa acatttctaa aagtggttct tgcagtgcta tacgtattgg tcacgttgga atgcaaattg agcacatcat tgaaaacatt gttgctgtca ccaaaggact ttcagaaaaa ttgccagaga agtgggagag cgtgaaactc ctgtttgtga aaactgagaa atcggctgca cttcccatct tttcctcgtt tgtcagcaat tgggatgaag ccaccaaaag atctttgctt aataagaaga aaaaagaggc aaggagaaaa cgaagagaaa gaaattttga aaaacaaaag gagaggaaga agaagaggca gcaggctagg aagactgcat cagttcttag taaagatgat gtggcacctg aaagtggtga tactacagtg aagaaacctg aatcaaagaa ggaacagacc ccagagcatg ggaagaaaaa acgtggcaga ggaaaagccc aagttaaagc aacaaatgaa tccgaagacg aaatcccaca gctggtacca ataggaaaga agactccagc taatgaaaaa gtagagattc aaaaacatgc cacaggaaag aagtctccag caaagagtcc taatcccagc acacctcgtg ggaagaaaag aaaggctttg ccagcatctg agaccccaaa agctgcagag tctgagaccc cagggaaaag cccagagaag aagccaaaaa tcaaagaaga ggcagtgaag gaaaaaagtc cttcgctggg gaaaaaagat gcgagacaga ctccaaaaaa gccagaggcc aagtttttca ccactcctag taaatctgtg agaaaagctt cccacacccc caaaaaatgg cccaaaaaac ccaaagtacc ccagtcgacc taa. It is sometimes possible for the material contained within the vial of "RSL1D1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
