SLMO1 cdna clone
SLMO1 cDNA Clone
Gene Names
PRELID3A; SLMO1; C18orf43; HFL-EDDG1
Synonyms
SLMO1; SLMO1 cDNA Clone; SLMO1 cdna clone
Sequence
ATGAAGATCTGGAGCTCGGAGCACGTGTTTGGCCACCCGTGGGACACGGTCATCCAGGCGGCCATGCGCAAGTACCCGAACCCGATGAACCCGAGCGTGCTGGGCGTGGATGTGCTACAGCGCCGCGTGGACGGCCGCGGCCGCCTGCACAGCTTGCGCCTGCTCAGCACCGAGTGGGGGCTGCCCAGCCTCGTGAGAGCGATTTTGGGAACCAGTAGGACATTGACATACATCCGAGAACATTCTGTGGTGGATCCAGTGGAAAAGAAAATGGAACTTTGTTCTACCAATATCACACTCACAAATTTGGTGTCAGTTAATGAGAGGTTGGTGTACACACCTCATCCAGAGAACCCAGAAATGACCGTGCTCACACAAGAAGCCATCATCACTGTGAAGGGGATTAGCCTTGGTAGTTATTTGGAAAGTTTAATGGCCAATACGATATCATCCAATGCAAAGAAGGGGTGGGCTGCTATCGAGTGGATAATTGAACACTCTGAAAGCGCTGTGAGCTAA
Sequence Length
519
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
16,825 Da
NCBI Official Full Name
Homo sapiens slowmo homolog 1 (Drosophila), mRNA
NCBI Official Synonym Full Names
PRELI domain containing 3A
NCBI Official Symbol
PRELID3A
NCBI Official Synonym Symbols
SLMO1; C18orf43; HFL-EDDG1
NCBI Protein Information
PRELI domain containing protein 3A
UniProt Protein Name
PRELI domain containing protein 3A
UniProt Gene Name
PRELID3A
UniProt Synonym Gene Names
C18orf43; SLMO1
UniProt Entry Name
PLD3A_HUMAN
Uniprot Description
SLMO1: Belongs to the slowmo family.
Chromosomal Location of Human Ortholog: 18p11.21
Cellular Component: mitochondrial intermembrane space
Molecular Function: protein binding
Biological Process: phospholipid transport
Research Articles on SLMO1
Similar Products
Product Notes
The SLMO1 prelid3a (Catalog #AAA1277460) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: ATGAAGATCT GGAGCTCGGA GCACGTGTTT GGCCACCCGT GGGACACGGT CATCCAGGCG GCCATGCGCA AGTACCCGAA CCCGATGAAC CCGAGCGTGC TGGGCGTGGA TGTGCTACAG CGCCGCGTGG ACGGCCGCGG CCGCCTGCAC AGCTTGCGCC TGCTCAGCAC CGAGTGGGGG CTGCCCAGCC TCGTGAGAGC GATTTTGGGA ACCAGTAGGA CATTGACATA CATCCGAGAA CATTCTGTGG TGGATCCAGT GGAAAAGAAA ATGGAACTTT GTTCTACCAA TATCACACTC ACAAATTTGG TGTCAGTTAA TGAGAGGTTG GTGTACACAC CTCATCCAGA GAACCCAGAA ATGACCGTGC TCACACAAGA AGCCATCATC ACTGTGAAGG GGATTAGCCT TGGTAGTTAT TTGGAAAGTT TAATGGCCAA TACGATATCA TCCAATGCAA AGAAGGGGTG GGCTGCTATC GAGTGGATAA TTGAACACTC TGAAAGCGCT GTGAGCTAA. It is sometimes possible for the material contained within the vial of "SLMO1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
