C3orf58 cdna clone
C3orf58 cDNA Clone
Gene Names
C3orf58; DIA1; HASF; GoPro49
Synonyms
C3orf58; C3orf58 cDNA Clone; C3orf58 cdna clone
Sequence
atgtggcgcctggtgcccccgaagctgggccgcctgtcccgctcgctgaagctggcggcgctgggcagcctgttggtgctgatggtgctgcactcgccgtcgctgctcgcctcttggcagcgcaacgaactgaccgaccggcgcttcctgcagctcaataagtgcccggcgtgcttcggcacgagctggtgccgccgcttcctcaacgggcaggtggtattcgaggcgtggggccgcttgcgcctgctggacttcctcaacgtgaagaacgtgtacttcgcgcagtacggcgagccccgcgagggcggccgccgccgagtggtgctcaagcgcctcggctcgcagcgcgagctggcgcagctcgaccagagcatctgcaagcgggccaccggccggccccgctgcgacctgctgcaggccatgccccggaccgagttcgcgcgcctcaacggcgacgtgcgtctgctcacgcccgaggcggtggagggctggtcggacctggtgcactgcccctcgcagcgccttctcgaccgcctggtgcgccgctacgcggagaccaaggactcgggcagcttcctgcttcgcaacctcaaggactcggagcgcatgcagctgctgctgaccctggccttcaaccccgagccgctggtgctacagagttttccgtctgatgaaggttggccatttgcaaagtatcttggagcttgtggaagaatggtggctgtaaattatgttggagaagaactgtggagttactttaatgcgccatgggaaaaacgagttgacctcgcttggcaattaatggaaatagcagaacagcttacaaacaatgactttgaatttgcactctacctcctggacgtcagctttgacaattttgcagttggtcctagagatgggaaggtaatcattgtggatgctgaaaatgttttggttgctgacaaaagattaattagacaaaataaacctgaaaattgggatgtatggtatgaaagcaagtttgatgactgtgataaggaggcttgcttatcattttcaaaagaaattctttgtgctcgtgccactgtggaccacaattactatgctgtttgtcagaacctcttatccagacatgccacctggcgtggcacttctggaggactccttcatgatccaccaagtgaaattgccaaagatggccggctcgaggccttgctggatgagtgtgccaacccaaagaagcgctatggcagattccaggctgcaaaagaactgcgtgaatacctagcacaattaagtaacaacgtgaggtag
Sequence Length
1293
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
25,230 Da
NCBI Official Full Name
Homo sapiens chromosome 3 open reading frame 58, mRNA
NCBI Official Synonym Full Names
chromosome 3 open reading frame 58
NCBI Official Symbol
C3orf58
NCBI Official Synonym Symbols
DIA1; HASF; GoPro49
NCBI Protein Information
deleted in autism protein 1
UniProt Protein Name
Deleted in autism protein 1
Protein Family
UniProt Gene Name
C3orf58
UniProt Synonym Gene Names
DIA1; GoPro49; HASF
UniProt Entry Name
DIA1_HUMAN
Uniprot Description
C3orf58: Genetic variations in C3orf58 may be associated with susceptibility to autism. Belongs to the DIA1 family. 2 isoforms of the human protein are produced by alternative splicing.
Protein type: Secreted, signal peptide; Secreted
Chromosomal Location of Human Ortholog: 3q24
Cellular Component: COPI vesicle coat; extracellular space; Golgi membrane
Biological Process: cardiac muscle cell proliferation; regulation of phosphoinositide 3-kinase cascade
Research Articles on C3orf58
Similar Products
CC058 Antibody
Host: Rabbit
Reactivity: Human, Mouse
Apps: Immunohistochemistry, ELISA, Western Blot
CC058 Antibody
Host: Rabbit
Reactivity: Human, Mouse
Apps: Immunohistochemistry, ELISA, Western Blot
Product Notes
The C3orf58 c3orf58 (Catalog #AAA1277452) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtggcgcc tggtgccccc gaagctgggc cgcctgtccc gctcgctgaa gctggcggcg ctgggcagcc tgttggtgct gatggtgctg cactcgccgt cgctgctcgc ctcttggcag cgcaacgaac tgaccgaccg gcgcttcctg cagctcaata agtgcccggc gtgcttcggc acgagctggt gccgccgctt cctcaacggg caggtggtat tcgaggcgtg gggccgcttg cgcctgctgg acttcctcaa cgtgaagaac gtgtacttcg cgcagtacgg cgagccccgc gagggcggcc gccgccgagt ggtgctcaag cgcctcggct cgcagcgcga gctggcgcag ctcgaccaga gcatctgcaa gcgggccacc ggccggcccc gctgcgacct gctgcaggcc atgccccgga ccgagttcgc gcgcctcaac ggcgacgtgc gtctgctcac gcccgaggcg gtggagggct ggtcggacct ggtgcactgc ccctcgcagc gccttctcga ccgcctggtg cgccgctacg cggagaccaa ggactcgggc agcttcctgc ttcgcaacct caaggactcg gagcgcatgc agctgctgct gaccctggcc ttcaaccccg agccgctggt gctacagagt tttccgtctg atgaaggttg gccatttgca aagtatcttg gagcttgtgg aagaatggtg gctgtaaatt atgttggaga agaactgtgg agttacttta atgcgccatg ggaaaaacga gttgacctcg cttggcaatt aatggaaata gcagaacagc ttacaaacaa tgactttgaa tttgcactct acctcctgga cgtcagcttt gacaattttg cagttggtcc tagagatggg aaggtaatca ttgtggatgc tgaaaatgtt ttggttgctg acaaaagatt aattagacaa aataaacctg aaaattggga tgtatggtat gaaagcaagt ttgatgactg tgataaggag gcttgcttat cattttcaaa agaaattctt tgtgctcgtg ccactgtgga ccacaattac tatgctgttt gtcagaacct cttatccaga catgccacct ggcgtggcac ttctggagga ctccttcatg atccaccaag tgaaattgcc aaagatggcc ggctcgaggc cttgctggat gagtgtgcca acccaaagaa gcgctatggc agattccagg ctgcaaaaga actgcgtgaa tacctagcac aattaagtaa caacgtgagg tag. It is sometimes possible for the material contained within the vial of "C3orf58, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
