Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

PAX6 cdna clone

PAX6 cDNA Clone

Gene Names
PAX6; AN; AN2; FVH1; MGDA; WAGR; D11S812E
Synonyms
PAX6; PAX6 cDNA Clone; PAX6 cdna clone
Ordering
 
When autocomplete results are available use up and down arrows to review and enter to select. Touch device users, explore by touch or with swipe gestures.
For Research Use Only!
Sequence
atgcagaacagtcacagcggagtgaatcagctcggtggtgtctttgtcaacgggcggccactgccggactccacccggcagaagattgtagagctagctcacagcggggcccggccgtgcgacatttcccgaattctgcaggtgtccaacggatgtgtgagtaaaattctgggcaggtattacgagactggctccatcagacccagggcaatcggtggtagtaaaccgagagtagcgactccagaagttgtaagcaaaatagcccagtataagcgggagtgcccgtccatctttgcttgggaaatccgagacagattactgtccgagggggtctgtaccaacgataacataccaagcgtgtcatcaataaacagagttcttcgcaacctggctagcgaaaagcaacagatgggcgcagacggcatgtatgataaactaaggatgttgaacgggcagaccggaagctggggcacccgccctggttggtatccggggacttcggtgccagggcaacctacgcaagatggctgccagcaacaggaaggagggggagagaataccaactccatcagttccaacggagaagattcagatgaggctcaaatgcgacttcagctgaagcggaagctgcaaagaaatagaacatcctttacccaagagcaaattgaggccctggagaaagagtttgagagaacccattatccagatgtgtttgcccgagaaagactagcagccaaaatagatctacctgaagcaagaatacaggtatggttttctaatcgaagggccaaatggagaagagaagaaaaactgaggaatcagagaagacaggccagcaacacacctagtcatattcctatcagcagtagtttcagcaccagtgtctaccaaccaattccacaacccaccacaccggtttcctccttcacatctggctccatgttgggccgaacagacacagccctcacaaacacctacagcgctctgccgcctatgcccagcttcaccatggcaaataacctgcctatgcaacccccagtccccagccagacctcctcatactcctgcatgctgcccaccagcccttcggtgaatgggcggagttatgatacctacacccccccacatatgcagacacacatgaacagtcagccaatgggcacctcgggcaccacttcaacaggactcatttcccctggtgtgtcagttccagttcaagttcccggaagtgaacctgatatgtctcaatactggccaagattacagt
Sequence Length
1267
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
– Da
NCBI Official Full Name
Homo sapiens paired box 6, mRNA
NCBI Official Synonym Full Names
paired box 6
NCBI Official Symbol
PAX6
NCBI Official Synonym Symbols
AN; AN2; FVH1; MGDA; WAGR; D11S812E
NCBI Protein Information
paired box protein Pax-6
UniProt Protein Name
Paired box protein Pax-6
Protein Family
UniProt Gene Name
PAX6
UniProt Synonym Gene Names
AN2
UniProt Entry Name
PAX6_HUMAN

NCBI Description

This gene encodes a homeobox and paired domain-containing protein that binds DNA and functions as a regulator of transcription. Activity of this protein is key in the development of neural tissues, particularly the eye. This gene is regulated by multiple enhancers located up to hundreds of kilobases distant from this locus. Mutations in this gene or in the enhancer regions can cause ocular disorders such as aniridia and Peter's anomaly. Use of alternate promoters and alternative splicing result in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2015]

Uniprot Description

PAX6: Transcription factor with important functions in the development of the eye, nose, central nervous system and pancreas. Required for the differentiation of pancreatic islet alpha cells. Competes with PAX4 in binding to a common element in the glucagon, insulin and somatostatin promoters. Regulates specification of the ventral neuron subtypes by establishing the correct progenitor domains. Isoform 5a appears to function as a molecular switch that specifies target genes. Defects in PAX6 are the cause of aniridia (AN). A congenital, bilateral, panocular disorder characterized by complete absence of the iris or extreme iris hypoplasia. Aniridia is not just an isolated defect in iris development but it is associated with macular and optic nerve hypoplasia, cataract, corneal changes, nystagmus. Visual acuity is generally low but is unrelated to the degree of iris hypoplasia. Glaucoma is a secondary problem causing additional visual loss over time. Defects in PAX6 are a cause of Peters anomaly (PAN). Peters anomaly consists of a central corneal leukoma, absence of the posterior corneal stroma and Descemet membrane, and a variable degree of iris and lenticular attachments to the central aspect of the posterior cornea. Defects in PAX6 are a cause of foveal hypoplasia (FOVHYP). Foveal hypoplasia can be isolated or associated with presenile cataract. Inheritance is autosomal dominant. Defects in PAX6 are a cause of keratitis hereditary (KERH). An ocular disorder characterized by corneal opacification, recurrent stromal keratitis and vascularization. Defects in PAX6 are a cause of coloboma of iris choroid and retina (COI); also known as uveoretinal coloboma. Ocular colobomas are a set of malformations resulting from abnormal morphogenesis of the optic cup and stalk, and the fusion of the fetal fissure (optic fissure). Severe colobomatous malformations may cause as much as 10% of the childhood blindness. The clinical presentation of ocular coloboma is variable. Some individuals may present with minimal defects in the anterior iris leaf without other ocular defects. More complex malformations create a combination of iris, uveoretinal and/or optic nerve defects without or with microphthalmia or even anophthalmia. Defects in PAX6 are a cause of coloboma of optic nerve (COLON). Defects in PAX6 are a cause of bilateral optic nerve hypoplasia (BONH); also known as bilateral optic nerve aplasia. A congenital anomaly in which the optic disc appears abnormally small. It may be an isolated finding or part of a spectrum of anatomic and functional abnormalities that includes partial or complete agenesis of the septum pellucidum, other midline brain defects, cerebral anomalies, pituitary dysfunction, and structural abnormalities of the pituitary. Defects in PAX6 are a cause of aniridia cerebellar ataxia and mental deficiency (ACAMD); also known as Gillespie syndrome. A rare condition consisting of partial rudimentary iris, cerebellar impairment of the ability to perform coordinated voluntary movements, and mental retardation. Belongs to the paired homeobox family. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Transcription factor; DNA-binding; Motility/polarity/chemotaxis

Chromosomal Location of Human Ortholog: 11p13

Cellular Component: cytoplasm; nuclear chromatin; nucleoplasm; nucleus

Molecular Function: DNA binding; histone acetyltransferase binding; protein binding; protein kinase binding; transcription factor activity; transcription factor binding; ubiquitin-protein ligase activity

Biological Process: blood vessel development; central nervous system development; eye development; glucose homeostasis; negative regulation of neurogenesis; organ morphogenesis; positive regulation of transcription from RNA polymerase II promoter; positive regulation of transcription, DNA-dependent; response to wounding; transcription from RNA polymerase II promoter; visual perception

Disease: Aniridia; Aniridia, Cerebellar Ataxia, And Mental Retardation; Coloboma Of Optic Nerve; Foveal Hypoplasia 1; Keratitis, Hereditary; Optic Nerve Hypoplasia, Bilateral; Peters Anomaly; Wilms Tumor, Aniridia, Genitourinary Anomalies, And Mental Retardation Syndrome

Research Articles on PAX6

Similar Products

Product Notes

The PAX6 pax6 (Catalog #AAA1277386) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcagaaca gtcacagcgg agtgaatcag ctcggtggtg tctttgtcaa cgggcggcca ctgccggact ccacccggca gaagattgta gagctagctc acagcggggc ccggccgtgc gacatttccc gaattctgca ggtgtccaac ggatgtgtga gtaaaattct gggcaggtat tacgagactg gctccatcag acccagggca atcggtggta gtaaaccgag agtagcgact ccagaagttg taagcaaaat agcccagtat aagcgggagt gcccgtccat ctttgcttgg gaaatccgag acagattact gtccgagggg gtctgtacca acgataacat accaagcgtg tcatcaataa acagagttct tcgcaacctg gctagcgaaa agcaacagat gggcgcagac ggcatgtatg ataaactaag gatgttgaac gggcagaccg gaagctgggg cacccgccct ggttggtatc cggggacttc ggtgccaggg caacctacgc aagatggctg ccagcaacag gaaggagggg gagagaatac caactccatc agttccaacg gagaagattc agatgaggct caaatgcgac ttcagctgaa gcggaagctg caaagaaata gaacatcctt tacccaagag caaattgagg ccctggagaa agagtttgag agaacccatt atccagatgt gtttgcccga gaaagactag cagccaaaat agatctacct gaagcaagaa tacaggtatg gttttctaat cgaagggcca aatggagaag agaagaaaaa ctgaggaatc agagaagaca ggccagcaac acacctagtc atattcctat cagcagtagt ttcagcacca gtgtctacca accaattcca caacccacca caccggtttc ctccttcaca tctggctcca tgttgggccg aacagacaca gccctcacaa acacctacag cgctctgccg cctatgccca gcttcaccat ggcaaataac ctgcctatgc aacccccagt ccccagccag acctcctcat actcctgcat gctgcccacc agcccttcgg tgaatgggcg gagttatgat acctacaccc ccccacatat gcagacacac atgaacagtc agccaatggg cacctcgggc accacttcaa caggactcat ttcccctggt gtgtcagttc cagttcaagt tcccggaagt gaacctgata tgtctcaata ctggccaaga ttacagt. It is sometimes possible for the material contained within the vial of "PAX6, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.
Looking for a specific manual?
Request a Manual