CLINT1 cdna clone

CLINT1 cDNA Clone

Gene Names

CLINT1; ENTH; EPN4; EPNR; CLINT

Synonyms

CLINT1; CLINT1 cDNA Clone; CLINT1 cdna clone

Ordering
Cat. Num. AAA1277372 For Research Use Only!

Sequence

atgttgaacatgtggaaggtgcgcgagctggtggacaaagccaccaatgttgttatgaattattcagagatcgagtctaaggttcgagaggcaacgaacgatgatccttggggaccttctgggcaactcatgggagagattgccaaggctacatttatgtatgaacaatttccagaacttatgaacatgctttggtcacgaatgttaaaagacaacaaaaagaattggagaagagtttataagtcgttgctgctcctagcttacctcataaggaatggatcagagcgtgttgttacaagtgccagagaacacatttatgatttacgatccctggaaaattaccactttgtagatgagcatggtaaggatcaaggtataaatattcgacagaaggtgaaggaattggttgaatttgcccaggatgacgacaggcttcgtgaagagcgaaagaaagcaaagaagaacaaagacaagtatgttggggtttcctcagacagtgttggaggattcagatacagtgaaagatatgatcctgagcccaaatcaaaatgggatgaggagtgggataaaaacaagagtgcttttccattcagtgataaattaggtgagctgagtgataaaattggaagcacaattgatgacaccatcagcaagttccggaggaaagatagagaagactctccagaaagatgcagcgacagcgatgaggaaaagaaagcgagaagaggcagatctcccaaaggtgaattcaaagatgaagaggagactgtgacgacaaagcatattcatatcacacaggccacagagaccaccacaaccagacacaagcgcacagcaaatccttccaaaaccattgatcttggagcagcagcacattacacaggggacaaagcaagtccagatcagaatgcttcaacccacacacctcagtcttcagttaagacttcagtgcctagcagcaagtcatctggtgaccttgttgatctgtttgatggcaccagccagtcaacaggaggatcagctgatttattcggaggatttgctgactttggctcagctgctgcatcaggcagtttcccttcccaagtaacagcaacaagtgggaatggagactttggtgactggagtgccttcaaccaagccccatcaggccctgttgcttccagtggcgagttctttggcagtgcctcacagccagcggtagaacttgttagtggctcacaatcagctctaggcccacctcctgctgcctcaaattcttcagacctgtttgatcttatgggctcgtcccaggcaaccatgacatcttcccagagtatgaatttctctatgatgagcactaacactgtgggacttggtttgcctatgtcaagatcacagaatacagatatggtccagaaatcagtcagcaaaaccttgccctctacttggtctgaccccagtgtaaacatcagcctagacaacttactacctggtatgcagccttccaaaccccagcagccatcactgaatacaatgattcagcaacagaatatgcagcagcctatgaatgtgatgactcaaagttttggagctgtgaacctcagttctccatcgaacatgcttcctgtccggccccaaactaatgctttgatagggggacccatgcctatgagcatgcccaatgtgatgactggcaccatgggaatggcccctcttggaaatactccgatgatgaaccagagcatgatgggcatgaacatgaacatagggatgtccgctgctgggatgggcttgacaggcacaatgggaatgggcatgcccaacatagccatgacttctggaactgtgcaacccaagcaagatgcctttgcaaatttcgccaattttagcaaataa

Sequence Length

1878

Vector

pENTR223.1 or pUC

Clone Sequence Report

Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #

33991087

NCBI GeneID

9685

Molecular Weight

70,295 Da

NCBI Official Full Name

Homo sapiens clathrin interactor 1, mRNA

NCBI Official Synonym Full Names

clathrin interactor 1

NCBI Official Symbol

CLINT1

NCBI Official Synonym Symbols

ENTH; EPN4; EPNR; CLINT

NCBI Protein Information

clathrin interactor 1

UniProt Protein Name

Clathrin interactor 1

Protein Family

Clathrin interactor

UniProt Gene Name

CLINT1

UniProt Synonym Gene Names

ENTH; EPN4; EPNR; KIAA0171; Clint; EpsinR

UniProt Entry Name

EPN4_HUMAN

NCBI Description

This gene encodes a protein with similarity to the epsin family of endocytic adapter proteins. The encoded protein interacts with clathrin, the adapter protein AP-1 and phosphoinositides. This protein may be involved in the formation of clathrin coated vesicles and trafficking between the trans-Golgi network and endosomes. Mutations in this gene are associated with a susceptibility to schizophrenia and psychotic disorders. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2010]

Uniprot Description

ENTH: Binds to membranes enriched in phosphatidylinositol 4,5- bisphosphate (PtdIns(4,5)P2). May have a role in transport via clathrin-coated vesicles from the trans-Golgi network to endosomes. Stimulates clathrin assembly. Belongs to the epsin family. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Adaptor/scaffold; Motility/polarity/chemotaxis

Chromosomal Location of Human Ortholog: 5q33.3

Cellular Component: cell-cell adherens junction; cytosol; Golgi apparatus; intracellular membrane-bound organelle; membrane; nucleoplasm

Molecular Function: clathrin binding; protein binding

Disease: Schizophrenia 1

Research Articles on CLINT1

1. Although epsinR has been shown to be a cargo adaptor, the present study indicates that it is an order of magnitude more abundant in CCVs than its known cargo protein, vti1b, suggesting that it may have other functions as well.

Similar Products

Product Notes

The CLINT1 clint1 (Catalog #AAA1277372) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgttgaaca tgtggaaggt gcgcgagctg gtggacaaag ccaccaatgt tgttatgaat tattcagaga tcgagtctaa ggttcgagag gcaacgaacg atgatccttg gggaccttct gggcaactca tgggagagat tgccaaggct acatttatgt atgaacaatt tccagaactt atgaacatgc tttggtcacg aatgttaaaa gacaacaaaa agaattggag aagagtttat aagtcgttgc tgctcctagc ttacctcata aggaatggat cagagcgtgt tgttacaagt gccagagaac acatttatga tttacgatcc ctggaaaatt accactttgt agatgagcat ggtaaggatc aaggtataaa tattcgacag aaggtgaagg aattggttga atttgcccag gatgacgaca ggcttcgtga agagcgaaag aaagcaaaga agaacaaaga caagtatgtt ggggtttcct cagacagtgt tggaggattc agatacagtg aaagatatga tcctgagccc aaatcaaaat gggatgagga gtgggataaa aacaagagtg cttttccatt cagtgataaa ttaggtgagc tgagtgataa aattggaagc acaattgatg acaccatcag caagttccgg aggaaagata gagaagactc tccagaaaga tgcagcgaca gcgatgagga aaagaaagcg agaagaggca gatctcccaa aggtgaattc aaagatgaag aggagactgt gacgacaaag catattcata tcacacaggc cacagagacc accacaacca gacacaagcg cacagcaaat ccttccaaaa ccattgatct tggagcagca gcacattaca caggggacaa agcaagtcca gatcagaatg cttcaaccca cacacctcag tcttcagtta agacttcagt gcctagcagc aagtcatctg gtgaccttgt tgatctgttt gatggcacca gccagtcaac aggaggatca gctgatttat tcggaggatt tgctgacttt ggctcagctg ctgcatcagg cagtttccct tcccaagtaa cagcaacaag tgggaatgga gactttggtg actggagtgc cttcaaccaa gccccatcag gccctgttgc ttccagtggc gagttctttg gcagtgcctc acagccagcg gtagaacttg ttagtggctc acaatcagct ctaggcccac ctcctgctgc ctcaaattct tcagacctgt ttgatcttat gggctcgtcc caggcaacca tgacatcttc ccagagtatg aatttctcta tgatgagcac taacactgtg ggacttggtt tgcctatgtc aagatcacag aatacagata tggtccagaa atcagtcagc aaaaccttgc cctctacttg gtctgacccc agtgtaaaca tcagcctaga caacttacta cctggtatgc agccttccaa accccagcag ccatcactga atacaatgat tcagcaacag aatatgcagc agcctatgaa tgtgatgact caaagttttg gagctgtgaa cctcagttct ccatcgaaca tgcttcctgt ccggccccaa actaatgctt tgataggggg acccatgcct atgagcatgc ccaatgtgat gactggcacc atgggaatgg cccctcttgg aaatactccg atgatgaacc agagcatgat gggcatgaac atgaacatag ggatgtccgc tgctgggatg ggcttgacag gcacaatggg aatgggcatg cccaacatag ccatgacttc tggaactgtg caacccaagc aagatgcctt tgcaaatttc gccaatttta gcaaataa. It is sometimes possible for the material contained within the vial of "CLINT1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Loading...

CLINT1 cdna clone