WDR67 cdna clone
WDR67 cDNA Clone
Gene Names
TBC1D31; Gm85; WDR67
Synonyms
WDR67; WDR67 cDNA Clone; WDR67 cdna clone
Sequence
atgcttaatgtttttgttgcactgacaaaagggcagtatccagtatttaatcaatatccaaagtttattgtggactatcaaacacaggaacgagaaagaataaggaatgatgaattggattacttaagagagaggcagacagttgaagatatgcaagctaaagtcgactcacaacgagttgaagatgaagcttggtaccagaaacaggagctgcttcgtaaagctgaagaaacaagaagagaaatgctcttacaagaggaggagaaaatgatacaacaaagacagaggctagctgctgtgaaaagagagctgaaagtaaaggaaatgcacttacaagacgctgcaagaaggcgttttctgaagcttcagcaagatcaacaggaaatggaactaagaagactggatgatgaaattgggagaaaggtatatatgagagatcgagaaattgctgccacagccagagacctagaaatgagacagctggaactcgaatcacaaaagagactttatgagaagaatcttactgaaaatcaagaagctcttgcaaaagaaatgcgagcagatgcagatgcctatagacgaaaagtggatcttgaagaacacatgtttcataagctgatagaagcaggtgaaacccagagccagaaaactcagaagtggaaggaagctgaaggaaaagagttccgtttgagatcagcaaagaaagcttctgctctttcagatgcgtctagaaagtggtttttaaagcaagagataaatgcggctgtagaacatgctgaaaatccatgtcataaagaagaacccaggttccaaaatgaacaggactcaagctgtttgcctagaacctcacaattaaatgactcttctgaaatggatccctcaacacagatttctttaaatagaagagcagtagaatgggacaccacgggacagaatcttattaagaaagtgagaaatcttcgccagagactcactgcccgggctcgtcacagatgtcaaacccctcatcttttggctgcatag
Sequence Length
1023
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
112,656 Da
NCBI Official Full Name
Homo sapiens WD repeat domain 67, mRNA
NCBI Official Synonym Full Names
TBC1 domain family member 31
NCBI Official Symbol
TBC1D31
NCBI Official Synonym Symbols
Gm85; WDR67
NCBI Protein Information
TBC1 domain family member 31
UniProt Protein Name
TBC1 domain family member 31
UniProt Gene Name
TBC1D31
UniProt Synonym Gene Names
WDR67
UniProt Entry Name
TBC31_HUMAN
Uniprot Description
WDR67: a WD40 repeat protein. WD40 repeats are found in a number of eukaryotic proteins that coordinate multi-protein complex assemblies. WD40 proteins are implicated in many functions including adaptor/regulatory modules in signal transduction, pre-mRNA processing and cytoskeleton assembly. Two alternatively spliced human isoforms have been described.
Protein type: Unknown function
Chromosomal Location of Human Ortholog: 8q24.13
Cellular Component: centrosome
Research Articles on WDR67
Similar Products
Product Notes
The WDR67 tbc1d31 (Catalog #AAA1277315) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcttaatg tttttgttgc actgacaaaa gggcagtatc cagtatttaa tcaatatcca aagtttattg tggactatca aacacaggaa cgagaaagaa taaggaatga tgaattggat tacttaagag agaggcagac agttgaagat atgcaagcta aagtcgactc acaacgagtt gaagatgaag cttggtacca gaaacaggag ctgcttcgta aagctgaaga aacaagaaga gaaatgctct tacaagagga ggagaaaatg atacaacaaa gacagaggct agctgctgtg aaaagagagc tgaaagtaaa ggaaatgcac ttacaagacg ctgcaagaag gcgttttctg aagcttcagc aagatcaaca ggaaatggaa ctaagaagac tggatgatga aattgggaga aaggtatata tgagagatcg agaaattgct gccacagcca gagacctaga aatgagacag ctggaactcg aatcacaaaa gagactttat gagaagaatc ttactgaaaa tcaagaagct cttgcaaaag aaatgcgagc agatgcagat gcctatagac gaaaagtgga tcttgaagaa cacatgtttc ataagctgat agaagcaggt gaaacccaga gccagaaaac tcagaagtgg aaggaagctg aaggaaaaga gttccgtttg agatcagcaa agaaagcttc tgctctttca gatgcgtcta gaaagtggtt tttaaagcaa gagataaatg cggctgtaga acatgctgaa aatccatgtc ataaagaaga acccaggttc caaaatgaac aggactcaag ctgtttgcct agaacctcac aattaaatga ctcttctgaa atggatccct caacacagat ttctttaaat agaagagcag tagaatggga caccacggga cagaatctta ttaagaaagt gagaaatctt cgccagagac tcactgcccg ggctcgtcac agatgtcaaa cccctcatct tttggctgca tag. It is sometimes possible for the material contained within the vial of "WDR67, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
