Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CHID1 cdna clone

CHID1 cDNA Clone

Gene Names
CHID1; GL008; SICLP; SI-CLP
Synonyms
CHID1; CHID1 cDNA Clone; CHID1 cdna clone
Ordering
For Research Use Only!
Sequence
atgcggacactcttcaacctcctctggcttgccctggcctgcagccctgttcacactaccctgtcaaagtcagatgccaaaaaagccgcctcaaagacgctgctggagaagagtcagttttcagataagccggtgcaagaccggggtttggtggtgacggacctcaaagctgagagtgtggttcttgagcatcgcagctactgctcggcaaaggcccgggacagacactttgctggggatgtactgggctatgtcactccatggaacagccatggctacgatgtcaccaaggtctttgggagcaagttcacacagatctcacccgtctggctgcagctgaagagacgtggccgtgagatgtttgaggtcacgggcctccacgacgtggaccaagggtggatgcgagctgtcaggaagcatgccaagggcctgcacatagtgcctcggctcctgtttgaggactggacttacgatgatttccggaacgtcttagacagtgaggatgagatagaggagctgagcaagaccgtggtccaggtggcaaagaaccagcatttcgatggcttcgtggtggaggtctggaaccagctgctaagccagaagcgcgtgggcctcatccacatgctcacccacttggccgaggctctgcaccaggcccggctgctggccctcctggtcatcccgcctgccatcacccccgggaccgaccagctgggcatgttcacgcacaaggagtttgagcagctggcccccgtgctggatggtttcagcctcatgacctacgactactctacagcgcatcagcctggccctaatgcacccctgtcctgggttcgagcctgcgtccaggtcctggacccgaagtccaagtggcgaagcaaaatcctcctggggctcaacttctatggtatggactacgcgacctccaaggatgcccgtgagcctgttgtcggggccaggtacatccagacactgaaggaccacaggccccggatggtgtgggacagccaggcctcagagcacttcttcgagtacaagaagagccgcagtgggaggcacgtcgtcttctacccaaccctgaagtccctgcaggtgcggctggagctggcccgggagctgggcgttggggtctctatctgggagctgggccagggcctggactacttctacgacctgctctag
Sequence Length
1182
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
41,678 Da
NCBI Official Full Name
Homo sapiens chitinase domain containing 1, mRNA
NCBI Official Synonym Full Names
chitinase domain containing 1
NCBI Official Symbol
CHID1
NCBI Official Synonym Symbols
GL008; SICLP; SI-CLP
NCBI Protein Information
chitinase domain-containing protein 1
UniProt Protein Name
Chitinase domain-containing protein 1
UniProt Gene Name
CHID1
UniProt Synonym Gene Names
SI-CLP
UniProt Entry Name
CHID1_HUMAN

Uniprot Description

CHID1: Saccharide- and LPS-binding protein with possible roles in pathogen sensing and endotoxin neutralization. Ligand-binding specificity relates to the length of the oligosaccharides, with preference for chitotetraose (in vitro). Belongs to the glycosyl hydrolase 18 family. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Hydrolase; Secreted, signal peptide; Secreted

Chromosomal Location of Human Ortholog: 11p15.5

Cellular Component: extracellular space; late endosome; lysosome; membrane; nucleus; trans-Golgi network

Molecular Function: chitin binding; chitinase activity; protein binding

Biological Process: chitin catabolic process

Research Articles on CHID1

Similar Products

Product Notes

The CHID1 chid1 (Catalog #AAA1277240) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcggacac tcttcaacct cctctggctt gccctggcct gcagccctgt tcacactacc ctgtcaaagt cagatgccaa aaaagccgcc tcaaagacgc tgctggagaa gagtcagttt tcagataagc cggtgcaaga ccggggtttg gtggtgacgg acctcaaagc tgagagtgtg gttcttgagc atcgcagcta ctgctcggca aaggcccggg acagacactt tgctggggat gtactgggct atgtcactcc atggaacagc catggctacg atgtcaccaa ggtctttggg agcaagttca cacagatctc acccgtctgg ctgcagctga agagacgtgg ccgtgagatg tttgaggtca cgggcctcca cgacgtggac caagggtgga tgcgagctgt caggaagcat gccaagggcc tgcacatagt gcctcggctc ctgtttgagg actggactta cgatgatttc cggaacgtct tagacagtga ggatgagata gaggagctga gcaagaccgt ggtccaggtg gcaaagaacc agcatttcga tggcttcgtg gtggaggtct ggaaccagct gctaagccag aagcgcgtgg gcctcatcca catgctcacc cacttggccg aggctctgca ccaggcccgg ctgctggccc tcctggtcat cccgcctgcc atcacccccg ggaccgacca gctgggcatg ttcacgcaca aggagtttga gcagctggcc cccgtgctgg atggtttcag cctcatgacc tacgactact ctacagcgca tcagcctggc cctaatgcac ccctgtcctg ggttcgagcc tgcgtccagg tcctggaccc gaagtccaag tggcgaagca aaatcctcct ggggctcaac ttctatggta tggactacgc gacctccaag gatgcccgtg agcctgttgt cggggccagg tacatccaga cactgaagga ccacaggccc cggatggtgt gggacagcca ggcctcagag cacttcttcg agtacaagaa gagccgcagt gggaggcacg tcgtcttcta cccaaccctg aagtccctgc aggtgcggct ggagctggcc cgggagctgg gcgttggggt ctctatctgg gagctgggcc agggcctgga ctacttctac gacctgctct ag. It is sometimes possible for the material contained within the vial of "CHID1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.