METTL1 cdna clone
METTL1 cDNA Clone
Gene Names
METTL1; TRM8; TRMT8; C12orf1; YDL201w
Synonyms
METTL1; METTL1 cDNA Clone; METTL1 cdna clone
Sequence
atggcagccgagactcggaacgtggccggagcagaggccccaccgccccagaagcgctactaccggcaacgtgctcactccaaccccatggcggaccacacgctgcgctaccctgtgaagccagaggagatggactggtctgagctatacccagagttcttcgctccactcactcaaaatcagagccacgatgacccaaaggataagaaagaaaagagagctcaggcccaagtggagtttgcagacataggctgtggctatggtggcctgttagtggaactgtcaccgctgttcccagacacacttattctgggtctggagatccgggtgaaggtctcagactatgtacaagaccggattcgggccctacgcgcagctcctgcaggtggcttccagaacatcgcctgtctccgtagcaatgccatgaagcaccttcctaacttcttctacaagggccagctgacaaagatgttcttcctcttccccgacccacatttcaagcggacaaagcacaagtggcgaatcatcagtcccaccctgctagcagaatatgcctacgtgctaagagttggggggctggtgtataccataaccgatgtgctggagctacacgactggatgtgcactcatttcgaagagcacccactgtttgagcgtgtgcctctggaggacctgagtgaagaccccgttgtgggacatctaggcacctcaactgaggaggggaagaaagttctacgtaatggagggaagaatttcccagccatcttccgaagaatacaagatcccgtcctccaggcagtgacctcccaaaccagcctgcctggtcactga
Sequence Length
831
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
17,423 Da
NCBI Official Full Name
Homo sapiens methyltransferase like 1, mRNA
NCBI Official Synonym Full Names
methyltransferase like 1
NCBI Official Symbol
METTL1
NCBI Official Synonym Symbols
TRM8; TRMT8; C12orf1; YDL201w
NCBI Protein Information
tRNA (guanine-N(7)-)-methyltransferase
UniProt Protein Name
tRNA (guanine-N(7)-)-methyltransferase
UniProt Gene Name
METTL1
UniProt Entry Name
TRMB_HUMAN
NCBI Description
This gene is similar in sequence to the S. cerevisiae YDL201w gene. The gene product contains a conserved S-adenosylmethionine-binding motif and is inactivated by phosphorylation. Alternative splice variants encoding different protein isoforms have been described for this gene. A pseudogene has been identified on chromosome X. [provided by RefSeq, Jul 2008]
Uniprot Description
METTL1: Catalyzes the formation of N(7)-methylguanine at position 46 (m7G46) in tRNA. Belongs to the methyltransferase superfamily. TrmB family.
Protein type: EC 2.1.1.33; Methyltransferase; RNA processing
Chromosomal Location of Human Ortholog: 12q13
Cellular Component: cytoplasm; nucleolus; nucleoplasm; nucleus
Molecular Function: protein binding; tRNA (guanine-N7-)-methyltransferase activity
Biological Process: tRNA modification
Research Articles on METTL1
Similar Products
Product Notes
The METTL1 mettl1 (Catalog #AAA1277235) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcagccg agactcggaa cgtggccgga gcagaggccc caccgcccca gaagcgctac taccggcaac gtgctcactc caaccccatg gcggaccaca cgctgcgcta ccctgtgaag ccagaggaga tggactggtc tgagctatac ccagagttct tcgctccact cactcaaaat cagagccacg atgacccaaa ggataagaaa gaaaagagag ctcaggccca agtggagttt gcagacatag gctgtggcta tggtggcctg ttagtggaac tgtcaccgct gttcccagac acacttattc tgggtctgga gatccgggtg aaggtctcag actatgtaca agaccggatt cgggccctac gcgcagctcc tgcaggtggc ttccagaaca tcgcctgtct ccgtagcaat gccatgaagc accttcctaa cttcttctac aagggccagc tgacaaagat gttcttcctc ttccccgacc cacatttcaa gcggacaaag cacaagtggc gaatcatcag tcccaccctg ctagcagaat atgcctacgt gctaagagtt ggggggctgg tgtataccat aaccgatgtg ctggagctac acgactggat gtgcactcat ttcgaagagc acccactgtt tgagcgtgtg cctctggagg acctgagtga agaccccgtt gtgggacatc taggcacctc aactgaggag gggaagaaag ttctacgtaa tggagggaag aatttcccag ccatcttccg aagaatacaa gatcccgtcc tccaggcagt gacctcccaa accagcctgc ctggtcactg a. It is sometimes possible for the material contained within the vial of "METTL1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
